Skip to main content

Table 1 Protein production information

From: Sequence similarity network analysis, crystallization, and X-ray crystallographic analysis of the lactate metabolism regulator LldR from Pseudomonas aeruginosa

Source organism

Pseudomonas aeruginosa

DNA source

Genomic DNA

Forward primer

CATATGATGGAATTTGGTCAGGTCAG

Reverse primer

GAATTCTTAGTCTTCCTGCACGCTG

Cloning vector

pEASY-Blunt

Expression vector

pET28a (+)

Expression host

Escherichia coli BL21 (DE3)

Complete amino acid sequence of the construct produced

MGSSHHHHHHSSGLVPRGSHMEFGQVRQRRLSDDIVAQLEAMILEGTLKSGERLPAERVLAEQFGVSRPSLREAIQKLVAKGLLVSRQGGGNYVTESLGATFSDPLLHLLEGNPEAQRDLLEFRHTLEGSCAYYAALRATSLDHQRLTEAFEALQACYARNDQVSAEEGAADARFHLAIAEASHNTVLLHTIKGLFDLLRRNVVTNIGGMYAQRTETRAQLMEQHQRLYDAIISGQAELAREVSNQHIHYVQEVLAEVQEEARRMKRSQRRRSVQED

  1. NdeI and EcoRI restriction sites were underlined. The extra amino acids added to the wild type PLldR are indicated in italics