Skip to main content

Table 1 Primers used in this work

From: Assembly of cellulases with synthetic protein scaffolds in vitro

Name Sequence
IPA-F GGAATTCCATATGATGCGAATTCTGGCTATC
IPA-R CCGCTCGAGTTCTTTGCCCGGAAGTTTC
IPa-F GGAATTCCATATGATGCGTGTACTGGGTATTG
IPa-R CCGCTCGAGCGCAGCCGGTAACTCCGCC
IPB-F GGAATTCCATATGATGAACGATGAAATGAAAG
IPB-R CCGCTCGAGGGCTTTATTCTGACGCCAC
IPb-F GGAATTCCATATGATGGCAAGATATTTGGG
IPb-R CCGCTCGAGCTTGGAGTAAAGCTCGAC
IPC-F GGAATTCCATATGATGACTGACAAAATGC
IPC-R CCGCTCGAGCGCTTCAATGGCAGCAC
IPc-F GGAATTCCATATGATGGCAACACGAATTG
IPc-R CCGCTCGAGTGGAATCAGCAGGCTGG
A-F GGAATTCCATATGTATGATGCTTCACTTATTCCG
A-R CCGCTCGAGGTTGCTTGGAAGCTTAC
E-F GTGCCGCGCGGCAGCCATATGATAGGACAAGCATTTGC
E-R GTGGTGGTGGTGGTGCTCGAGAGTTGGAGGAGTCACTGACCC
4-F GGAATTCCATATGCAATACGATCAGATAGATAAA
4-R CCGCTCGAGCAGAGCAAGAGCTATAG
IPaA-F GTGCCGCGCGGCAGCATGCGTGTACTGGGTATTGAAACTTC
IPaA-R AAGTGAAGCATCATACGATCCGCCACCGCCAGAGCCACCTCCGCCCGCAGCCGGTAACTCCG
AIPa-F AAGCTTCCAAGCAACGGCGGAGGTGGCTCTGGCGGTGGCGGATCGCGTGTACTGGGTATTG
AIPa-R GTGGTGGTGGTGGTGCGCAGCCGGTAACTCCGCCAGCGGC
IPbE-F GTGCCGCGCGGCAGCATGGCAAGATATTTGGGTCCTAAGC
IPbE-R AAATGCTTGTCCTATCGATCCGCCACCGCCAGAGCCACCTCCGCCCTTGGAGTAAAGCTCG
EIPb-F GTGACTCCTCCAACTGGCGGAGGTGGCTCTGGCGGTGGCGGCAAGATATTTGGGTCCTAAGC
EIPb-R GTGGTGGTGGTGGTGCTTGGAGTAAAGCTCGACGATCAGGTG
IPc4-F GTGCCGCGCGGCAGCATGACTGACAAAATGCAAAGTTTAG
IPc4-R TATCTGATCGTATTGCGATCCGCCACCGCCAGAGCCACCTCCGCCCGCTTCAATGGCAGCAC
4IPc-F ATAGCTCTTGCTCTGGGCGGAGGTGGCTCTGGCGGTGGCGGATCGACTGACAAAATGCAAAG
4IPc-R GTGGTGGTGGTGGTGCGCTTCAATGGCAGCACGCAATTTTTTC
ScafBAC-F1 TAAGAAGGAGATATAAACGATGAAATGAAAGGTAAAAGCGGC
ScafBAC-F2 CGTCAGAATAAAGCCGGCGGAGGTGGCTCTGGCGGTGGCGGATCGCGAATTCTGGCTATCG
ScafBAC-F3 CTTCCGGGCAAAGAAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGACTGACAAAATGCAAAGTT
ScafBAC-R GTGGTGGTGGTGGTGCTCGAGCGCTTCAATGGCAGCACGC
ScafABC-F1 TAAGAAGGAGATATACGAATTCTGGCTATCGATACCGCGACAGAGGCCTGCTC
ScafABC-F2 CTTCCGGGCAAAGAAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGAACGATGAAATGAAAGG
ScafABC-F3 CGTCAGAATAAAGCCGGCGGAGGTGGCTCTGGCGGTGGCGGATCGACTGACAAAATGCAAAG
ScafBCA-F GCTGCCATTGAAGCGGGCGGAGGTGGCTCTGGCGGTGGCGGATCGCGAATTCTGGCTATCG
ScafBCA-R GTGGTGGTGGTGGTGTTCTTTGCCCGGAAGTTTCTTCCATGC