Skip to main content

Advertisement

Table 1 Primers used in this study

From: Enhancing transglutaminase production of Streptomyces mobaraensis by iterative mutagenesis breeding with atmospheric and room-temperature plasma (ARTP)

Name Sequences (5′–3′) Application
16S rRNA_L1 AGCAGCGGAGCATGTGGCTT 16S rRNA gene transcription
16S rRNA_R1 TGCGCTCGTTGCGGGACTTA
pro-smtg-L1 CATGTCGAGGGACAGGAACA pro-smtg gene transcription
pro-smtg-R1 TTGCGGAACTTGCTCTCGTA
pro-smtg-FP CGGAATTCATGCCGTCCGCAGGC pro-smtg gene amplification
pro-smtg-RP CCCAAGCTTTCACGGCCAGCCCTG