Exotic glycerol dehydrogenase expressing Escherichia coli increases yield of 2,3-butanediol

Abstract

Background

The thriving of biodiesel industry has led to produce 10% (v/v) crude glycerol, thus creating an overflow problem. Biofuel production is restricted by Escherichia coli due to its toxicity to bacterial cells. Therefore, a platform chemical and fuel additive 2,3-butanediol (2,3-BD) with low toxicity to microbes could be a promising alternative for biofuel production by recombinant E. coli using glycerol as the sole substrate.

Results

A novel expression system of E. coli was developed to express the dhaD gene encoding glycerol dehydrogenase (GDH) to produce value-added metabolic products through aerobic biotransformation of glycerol. The dhaD gene obtained from Klebsiella pneumoniae SRP2 was expressed in E. coli BL21(DE3)pLysS using an E. coli–K. pneumoniae shuttle vector pJET1.2/blunt consisting of chloramphenicol-resistance gene under the control of the T7lac promotor. RT-PCR analysis and dhaD overexpression confirmed that the 2,3-BD synthesis pathway gene was expressed on RNA and protein levels. Therefore, the recombinant E. coli exhibited a 38.9-fold higher enzyme activity (312.57 units/mg protein), yielding 8.97 g/L 2,3-BD, a 2.4-fold increase with respect to the non-recombinant strain.

Conclusions

The engineered strain E. coli BL21(DE3)pLysS/pJET1.2/blunt-dhaD, carrying the 2,3-BD pathway gene dhaD from our newly isolated Klebsiella pneumoniae SRP2 strain, displayed the best ability to synthesize 2,3-BD from low-cost biomass glycerol. The value of expression of an important glycerol metabolism gene dhaD is the highest ever achieved with an engineered E. coli strain. From these results, the first reported dhaD expression system has paved the way for improvement of 2,3-BD production and is efficient for another heterologous gene expression in E. coli.

Background

With increasing fossil fuel price and environmental concern, alternative and renewable energy sources have become attractive. Biodiesel, a renewable and promising combustion fuel, is synthesized from vegetable oils and animal fats. However, the biodiesel synthesis process (transesterification) generates 10% crude glycerol as a core by-product which is the cheapest feedstock or negative-value biomass to produce a high-value green product, 2,3-BD (Rahman et al. 2015). 2,3-BD is an important platform chemical, and it is also known as an excellent building block in the synthesis of valuable chiral chemicals (Celinska and Grajek 2009; Zeng and Sabra 2011). Chemical biosynthesis processes for the production of optically pure 2,3-BD are difficult to control, complicated and expensive. Thus, the biotransformation process has been considered as the preferred method for the production of optically pure 2,3-BD (Celinska and Grajek 2009; Ji et al. 2011; Zeng and Sabra 2011). Several engineered strains of microorganisms including Saccharomyces cerevisiae, Enterobacter cloacae, Bacillus licheniformis and E. coli have been used for the production of optically pure 2,3-BD (Yan et al. 2009; Lian et al. 2014; Li et al. 2015; Wang et al. 2012).

In the past few years, several microorganisms including cyanobacteria, fungi and bacteria have been proved to produce biofuels and fuel additives using different biomasses (Domínguez de María 2011; Gross 2012; Yan et al. 2009]. E. coli is extensively used as a model organism for biofuel production using pentose and hexose sugars from lignocellulosic biomass (Bokinsky et al. 2011). Now, it has been proved that recombinant E. coli can produce numerous biofuels including ethanol, acetone, butanol, α-pinene, isoprenol, isobutanol and fatty alcohols through biosynthetic pathways (Bokinsky et al. 2011; May et al. 2013; Atsumi et al. 2008; Zhang et al. 2013; Yang et al. 2013). Nevertheless, these biofuels are highly toxic to E. coli, and the production of new end products which are less or non-toxic to microbial cells is needed to obtain high product yield (Baez et al. 2011) using low-cost or negative-cost biomass. Thus, less toxic metabolic products such as 2,3-BD, 1,3-propanediol (1,3-PDO) and acetoin can be produced through biotechnological routes (Ji et al. 2011). Moreover, an industrially important platform chemical 2,3-BD could be produced through the oxidative pathway of recombinant E. coli (Xu et al. 2007). A high heating value (27,200 J/g) bulk chemical 2,3-BD could be used as liquid fuel or fuel additive (Xiao et al. 2012); it has very low toxicity to bacterial cells (Oliver et al. 2013). Therefore, 2,3-BD could be a promising alternative for biofuel production through recombinant E. coli strains.

Several bacterial species including Klebsiella pneumoniae, K. variicola, K. oxytoca, Serratia marcescens and Enterobacter cloacae have been used to produce 2,3-BD with high yields through optimization of culture conditions or genetic engineering (Celinska and Grajek 2009; Kim et al. 2013), but these strains are pathogenic or opportunistic pathogens and have been categorized under risk group-2 microorganisms, unsuitable for industrial-scale biotransformation (Ji et al. 2011; Kim et al. 2013). The microorganisms that may cause disease in humans and animals but are unlikely to be a serious hazard to laboratory personnel, the community, animals or the environment are called risk group 2. However, the strain E. coli BL21(DE3)pLysS has been known to be non-pathogenic and does not carry any virulence factor or pathogenic mechanism causing infections (Chart et al. 2000). Consequently, E. coli BL21(DE3)pLysS strain could be the best candidate for the safe synthesis of bioproducts (Chart et al. 2000; Zhang et al. 2013). Therefore, in this research work, a preliminary attempt has been made to establish a method for 2,3-BD production efficiently using E. coli BL21(DE3)pLysS. Moreover, in the oxidative pathway of glycerol metabolisms, there are three key enzymes, viz., glycerol dehydrogenase (GDH), α-acetolactate synthase and acetoin reductase which are involved in 2,3-BD biosynthesis (Celinska and Grajek 2009; Zhang et al. 2013). Consequently, GDH is the first enzyme in the oxidative pathway for converting glycerol to dihydroxyacetone(DHA), and then 2,3-BD is produced through pyruvate (Rahman et al. 2015) (Fig. 1). Several works have been reported on the production of 2,3-BD by recombinant E. coli through metabolic engineering of the genes, budB and budC, responsible for α-acetolactate synthase and acetoin reductase enzymes, respectively (Li et al. 2012), but there is no report on the dhaD gene in the same pathway which is responsible for GDH enzyme production. Therefore, it is important to construct an efficient 2,3-BD biosynthesis pathway that includes the related gene cluster to improve 2,3-BD production. In this backdrop, our aim was to construct a novel dhaD expression system in E. coli and its application for 2,3-BD production under completely aerobic condition. In this work, a systematic approach has been taken to construct and optimize 2,3-BD production by an efficient engineered E. coli BL21(DE3)pLysS strain. This research work is the first step for systematic metabolic engineering, which we successfully made as the novel expression system of the dhaD gene, and a high enzyme activity (GDH) was achieved through batch biotransformation process using glycerol as the sole carbon source.

Fig. 1

Metabolism pathway for the conversion of glycerol to 2,3-BD. Pyruvate is reduced to various organic compounds, depending on the microorganism and on the biotransformation conditions

Methods

Enzymes and chemicals

2,3-Butanediol (99.0%) was purchased from Sigma Aldrich (Canada). The restriction enzymes, Fast Pfu DNA polymerase and T4 DNA ligase, were purchased from Thermo Fisher Scientific, Canada. Isopropyl-β-d-thiogalactoside (IPTG), ampicillin and chloramphenicol were purchased from BioShop, Canada. All other chemicals used in this research work were analytical-grade reagents and commercially available.

Bacterial strains and vector

Newly isolated K. pneumoniae SRP2 was used for isolation and amplification of the dhaD gene. E. coli JM109 and E. coli BL21(DE3)pLysS strains were used as the hosts for gene cloning and expression, respectively. E. coli BL21(DE3)pLysS was also used as a host strain for 2,3-BD production. Cloning vector pJET1.2/blunt (Thermo Fisher Scientific, Canada) and E. coli BL21(DE3)pLysS contained ampicillin- and chloramphenicol-resistant genes, respectively.

Media and growth conditions

Klebsiella pneumoniae SRP2 and E. coli JM109 were grown in a Luria–Bertani (LB) medium containing (g/L): peptone 10.0 g/L, yeast extract 5.0 g/L and sodium chloride 5.0 g/L. The LB broth medium was supplemented with 100 μg/mL ampicillin and 100 μg/mL ampicillin plus 34 μg/mL chloramphenicol for E. coli JM109 and E. coli BL21(DE3)pLysS/dhaD, respectively, when necessary to maintain the plasmids. For biotransformation or expression study of E. coli BL21(DE3)pLysS/dhaD, MS-2 medium (K₂HPO₄ 0.1 g/L, NaNO₃ 0.1 g/L, MgSO₄.7H₂O 0.05 g/L, KCl 0.1 g/L, yeast extract 2.5 g/L and peptone 5.0 g/L) supplemented with 25.0 g/L glycerol, 100 μg/mL ampicillin and 34 μg/mL chloramphenicol was used. The initial pH of the medium was adjusted to 7.0 by adding NaOH/HCl. The biotransformation was carried out in a 250-mL flask containing 50.0 mL medium with 5.0 mL seed culture using a rotary shaker incubator at 200 rpm and 37 °C under aerobic condition. All the seeds and culture media of the E. coli BL21(DE3)pLysS/dhaD were supplemented with ampicillin (100 μg/mL) and chloramphenicol (34 μg/mL) to maintain the plasmid.

Construction of plasmid with the dhaD gene

The dhaD gene encoding glycerol dehydrogenase was amplified through PCR using K. pneumoniae SRP2 genomic DNA as the template. The primers used in PCR were: forward primer—GGATCCATGCGCACTTATTTGAGGGTGA (with BamH1 restriction site) and reverse primer—AAGCTTACGCGCCAGCCACTGGCCT (with HindIII restriction site). The PCR conditions were as follows: initial denaturation at 94 °C for 3 min; then 30 cycles of 30 s at 94 °C, 30 s at 58 °C and 1 min at 72 °C; and final extension at 72 °C 10 min. The amplified product was ligated into cloning vector pJET1.2/blunt at the PCR product site and transferred into E. coli JM109 using calcium chloride heat shock method (Ausubel et al. 1987), resulting in a recombinant plasmid designated as pJET1.2/blunt-dhaD. The ampicillin-resistant colonies were selected on the LB agar plate supplemented with 100 μg/mL ampicillin and purified. However, the plasmid containing the dhaD gene was extracted from E. coli JM109, purified and transferred to the competent cell of E. coli BL21(DE3)pLysS using calcium chloride heat shock method (Ausubel et al. 1987). The recombinant E. coli BL21(DE3)pLysS/pJET1.2/blunt-dhaD designated as E. coli BL21(DE3)pLysS/dhaD was obtained using the heat shock transformation method (Ausubel et al. 1987).

Expression and SDS-PAGE analysis of dhaD

The transformed E. coli BL21(DE3)pLysS containing plasmid pJET1.2/blunt-dhaD was grown at 37 °C in LB medium supplemented with 100 μg/mL ampicillin and 34 μg/mL chloramphenicol for 24 h with shaking at 200 rpm. This overnight culture was inoculated into fresh LB medium containing antibiotics to an OD₆₀₀ of 0.05–0.1 (1:50 dilution of the overnight culture). One set of glycerol stock culture was stored at − 80 °C until the clone that best expressed the targeted protein was obtained. The cultures were grown until they reach mid-log phase (OD₆₀₀ = 0.4–0.5, 2–3 h). Subsequent incubation, the cultures were induced by adding IPTG to a final concentration of 0.5 mM, and incubated for an additional 2–4 h, took time points to analyze for optimal expression of targeted protein. Clones were then used for enzymatic assay to determine which clone best expressed the protein of interest. Cells were harvested after 4–7 h of incubation and resuspended in 100 mM potassium phosphate buffer containing 50 mM KCl, sonicated at 4 °C for 2 min (10 s at a time, and until 2 min) and centrifuged (3–5 min at 15,000×g). The supernatant was kept at low temperature (4 °C) and used for protein and GDH enzyme assays. The protein samples were separated by SDS-PAGE using 12% (w/v) SDS-polyacrylamide gel and identified by staining with Coomassie Brilliant Blue R-250 (Merck). SDS-PAGE analysis was carried out using the Laemmli method (Laemmli 1970). The SDS-PAGE analysis was performed on the Mini-PROTEAN Tetra System Electrophoresis (Bio-Rad, Canada). The Broad Range Protein Molecular Marker (Fermentas) was used to estimate the molecular weight of proteins.

Expression: RT-PCR analysis and enzyme assay

To study the expression of the dhaD gene responsible for glycerol utilization in IPTG-induced strain E. coli BL21(DE3)pLysS/dhaD, the experiment was carried out with quantitative real-time polymerase chain reaction (qRT-PCR). Total RNA was extracted using the PureLink^™ RNA extraction kit (Ambion, Thermo Fisher Scientific, USA), following the manufacturer’s instructions. The expression of the dhaD gene was evaluated via qRT-PCR. First-strand cDNA was prepared by reverse transcription using the cDNA synthesis kit (Tetro cDNA synthesis Kit, Bioline, UK) in which RNA was used as a template. Quantitative gene expression was carried out using SensiFAST™ SYBR No-ROX Kit (Bioline, UK) on C1000™ thermal cycler quantitative real-time PCR (qRT-PCR) detector system (Bio-Rad, USA). The 16S rRNA obtained based on the primers 5′-GCGGTTGTTACAGTCAGATG-3′ and 5′-GCCTCAGCGTCAGTATCG-3′ was used as an internal standard. The 2^−ΔΔCTmethod was used to analyze the fold change gene expression over the control (Lival and Schmittgen 2001).

However, the intracellular GDH activity was determined at room temperature by measuring the reduction of NAD⁺ to the substrate-dependent absorbance change of NAD(H) at 340 nm (ε340 = 6.22 mM⁻¹ cm⁻¹) using the method described by Ahrens et al. (1998) with slight modification (Rahman et al. 2015). Briefly, 1 mL of the reaction mixture contains 50 mM potassium phosphate buffer (pH 8.0), 30 mM ammonium sulfate, 0.2 M glycerol and 1.2 mM NAD. The assay was initiated by adding 50 µL of cell extract in 250 µL reaction mixture, and the absorbance increase (NADH) was observed from the spectrophotometer for 2–3 min. One unit of activity is the amount of enzyme required to reduce 1 µmol of substrate per minute. The specific activity of GDH is expressed as μmol of substrate reduced/min/mg of cell protein, and represents the averages for at least three cell preparations. The Bradford method was used for the determination of protein concentration (Bradford 1976) and bovine serum albumin served as the standard protein.

Analytical

The biomass concentration was measured from absorbance at 600 nm. The optical density at 600 nm (OD₆₀₀) was obtained from a microplate spectrophotometer (EPOCH, BioTek). The metabolic product was identified by GC–MS (Varian 1200 Quadrupole). The concentrations of major metabolic product 2,3-BD, as well as glycerol, were quantified using a GC–FID (Shimatzu GC 14A) under the following conditions: sample volume 1 µL; column temperature range from 45 °C (2 min) to 240 °C at the rate of 10 °C min⁻¹; the injector and detector temperature 250 °C; carrier gas, nitrogen; column, DB-WAXetr. The injecting sample was purified by centrifugation (Fisher Scientific, Germany, accu Spin Micro 17), and membrane filter (0.22 μm pore size), respectively.

Statistical analysis

All the experiments were performed in triplicate and the results expressed in terms of mean ± SD (standard deviation). The statistical analysis of data was performed to test the significant difference by one-way analysis of variance (ANOVA) followed by Tukey’s honest significant difference (HSD) test (p < 0.05).

Results and discussion

Construction of plasmid with the dhaD gene

The vector pJET1.2/blunt was used for cloning the dhaD gene encoding glycerol dehydrogenase (GDH). After ligation of the amplified product (dhaD) into the cloning vector pJET1.2/blunt, the vector was transferred into E. coli JM109, resulting in recombinant E. coli JM109/pJET1.2/blunt-dhaD (Fig. 2). The ampicillin-resistant colonies were selected from LB agar plates supplemented with 100 μg/mL ampicillin and purified. For the confirmation of dhaD, the plasmid was extracted from transformed E. coli JM109/pJET1.2/blunt-dhaD strain. Transformation of the plasmid containing the dhaD gene into E. coli JM109 was confirmed by agarose gel electrophoresis analysis (Fig. 3). The size of 1125 bp of the dhaD gene, amplified by PCR from the vector (plasmid) using dhaD gene primers (forward and reverse primers), was also confirmed by sequencing.

Fig. 2

Construction of recombinant vector for dhaD expression. PlacUV5 modified P_lac promotor for expression of the eco47IR gene at a level sufficient to allow for positive selection, eco47IR lethal gene enables positive selection of recombinant plasmid, dhaD inserted gene glycerol dehydrogenase, PT7 T7 RNA polymerase promotor for in vitro transcription of the cloned insert, AMP gene resistant to ampicillin, rep replicon from pMBI plasmid responsible for the replication of pJET1.2

Fig. 3

Agarose gel electrophoresis analysis of dhaD gene amplified from the plasmid of E. coli JM109. Lane P1, P2 and P2—PCR products from the plasmid of E. coli JM109 containing dhaD genes; lane C1—negative control (no plasmid); lane M—molecular mass markers. Recombinant glycerol dehydrogenase (dhaD) from K. pneumoniae SRP2 is indicated by 1125 bp

Clone selection of engineered E. coli BL21(DE3)pLysS/dhaD strains

However, for selection of the best clone, totally six transformed E. coli BL21(DE3)pLysS/dhaD clones were tested for their GDH enzyme activity after 3 h of IPTG induction. All the six clones were almost identical in their enzyme activities, and one of the clones exhibited the highest activity of GDH which was 312.57 U/mg protein (Table 1). Thus, this clone was finally selected for the expression study, nominated as E. coli BL21(DE3)pLysS/dhaD strain. Therefore, this recombinant stain E. coli BL21(DE3)pLysS/dhaD also exhibited the highest biomass production (OD₆₀₀ = 1.27) compared to that of non-recombinant E. coli BL21(DE3)pLysS and K. pneumoniae SRP2 (Table 1).

Table 1 Glycerol dehydrogenase (GDH) activity of the clone constructed with dhaD containing plasmid

However, to confirm that the dhaD gene had inserted into E. coli BL21(DE3)pLysS, agarose gel electrophoresis analysis and gene sequencing were performed. The open reading frame (ORF) of dhaD gene was 1125 bp (Fig. 4). Also, the correct size of 1125 bp of the PCR product (dhaD gene), obtained from the recombinant vector containing the dhaD gene using forward and reverse primers, was confirmed by sequencing.

Fig. 4

Agarose gel electrophoresis analysis of dhaD gene amplified from the plasmid of E. coli BL21(DE3)pLysS/dhaD. Lane P1 and P2—PCR products from the plasmid of E. coli BL21(DE3)pLysS containing the dhaD gene; lane C2—negative control (no plasmid); lane M—molecular mass markers. Recombinant glycerol dehydrogenase (dhaD) (1125 bp) (lane P1 or P2) from K. pneumoniae SRP2 is indicated by a line

Enzyme activity

To compare the expression levels of non-recombinant E. coli BL21(DE3)pLysS, recombinant E. coli BL21(DE3)pLysS/dhaD and a wild-type K. pneumoniae SRP2 strains after induced IPTG (0.5 mM), GDH enzyme activities were determined in vitro. As shown in Fig. 5, when the GDH-expressing plasmid pJET1.2/blunt-dhaD was introduced into E. coli BL21(DE3)pLysS, the resultant strain E. coli BL21(DE3)pLysS/dhaD displayed a significant increase in GDH activity which was 312.57 U/mg protein, 38.9 times more than that of E. coli BL21(DE3)pLysS and 9.99 times more than wild-type strain K. pneumoniae SRP2 (Fig. 5a and Table 1). Similarly, the overexpression of the GDH gene in E. coli BL21(DE3)pLysS did not lead to a significantly enhanced GDH activity after induction with IPTG (Fig. 5a). Moreover, the recombinant GDH was not only highly induced by different concentrations of IPTG, but also markedly stimulated at 37 °C incubation temperature (Fig. 5c). Consequently, at an incubation temperature of 37 °C, the highest intracellular GDH activity was obtained using 0.5 mM IPTG (Fig. 5c). Similar effects had been observed previously in Gluconobacter oxydans MF1 when the gene coding for glucose dehydrogenase or gluconate-5-dehydrogenase was overexpressed (Merfort et al. 2006).

Fig. 5

Comparison of GDH enzyme activities of the strains E. coli BL21(DE3)pLysS(DE3), E. coli BL21(DE3)pLysS/dhaD (DE3/dhaD) and K. pneumoniae SRP2 (SRP2): a effect of incubation time on GDH activity after addition of 0.5 mM IPTG; b effect of incubation time on biomass production after addition of 0.5 mM IPTG; c effect of incubation temperature and IPTG concentrations on GDH activity after 3 h of IPTG induction; d effect of medium initial pH on GDH activity after 3 h of 0.5 mM IPTG induction

Moreover, the GDH enzyme activity was evaluated with the strain E. coli BL21(DE3)pLysS and its plasmid containing strain E. coli BL21(DE3)pLysS/dhaD, and was found to be on average 38.9.00-fold increased in E. coli BL21(DE3)pLysS/dhaD, which was directly correlated with an increase in the expression of GDH from plasmid pJET1.2/blunt. As shown in Fig. 5a, b, the GDH activity was increased during the late log and stationary phases of growth with the strain E. coli BL21(DE3)pLysS/dhaD, which was much higher than E. coli BL21(DE3)pLysS. Furthermore, the recombinant strain BL21(DE3)pLysS/dhaD exhibited the highest enzyme activity at a pH 7.0 (Fig. 5d).

Gene expression by RT-PCR analysis

However, for determining the expressions of the GDH gene in E. coli BL21(DE3)pLysS, E. coli BL21(DE3)pLysS/dhaD and K. pneumoniae SRP2 strains, qRT-PCR analysis was performed. qRT-PCR analysis was performed on bacteria having undergone glycerol transformation by the dhaD gene expression construct, which was obtained from K. pneumoniae SRP2. The use of two antibiotics (ampicillin, chloramphenicol) allowed the stable maintenance of plasmid in the recombinant bacterium. qRT-PCR analysis exhibited the expression of the dhaD gene from K. pneumoniae after the addition of IPTG as an inducer (Fig. 6). As gene expression often varied significantly in different growth phases (Quintero et al. 2009), all bacterial cells used for RNA isolation were cultured for a constant period to minimize its effect on RT-PCR analysis. It was undoubtedly observed that the transcription level of the GDH gene in E. coli BL21(DE3) pLysS/dhaD was much higher than that of the control strain E. coli BL21(DE3)pLysS (Fig. 6). In E. coli BL21(DE3)pLysS/dhaD, the expression level of the GDH gene was about 84 times more abundant than that in E. coli BL21(DE3)pLysS after 3 h of IPTG induction, due to GDH overexpression. Therefore, the results confirmed the expression of dhaD in the E. coli BL21(DE3)pLysS/dhaD expression system.

Fig. 6

Comparison of expression levels of dhaD of the strains E. coli BL21(DE3)pLysS (DE3), E. coli BL21(DE3)pLysS/dhaD (DE3/dhaD) and K. pneumoniae SRP2 (SRP2). Incubation temperature and IPTG concentration were 37 °C and 0.5 mM, respectively

Overexpression of the pJET1.2/blunt-dhaD construct

The E. coli BL21(DE3)pLysS strain contained a fragment of the DE3 phage genome in the genome system has a T7 RNA polymerase gene under the control of the lacUV5 promoter. Logically, the bacterium contains the lacI gene in the chromosome and expression plasmid, which encodes a repressor that binds to the T7lac promoter on the expression plasmid and the lacUV5 operator–promoter, thereby blocking the expression of the gene encoding RNA polymerase. This repression is induced by IPTG which allows induced transcription from the T7lac promoter (ThermoFisher Scientific 2010). The gene dhaD was transcribed in a similar way and controlled by the T7lac promoter. The results indicate efficient overexpression of the dhaD gene from K. pneumoniae SRP2 in E. coli BL21(DE3)pLysS (Fig. 6). SDS-PAGE analysis of the expression products from genes inserted into the pJET1.2/blunt-dhaD construct indicates a higher level of the expressed protein in E. coli BL21(DE3)pLysS strain (Fig. 7). As shown in Fig. 7, the sample showed a protein brand of about 41 kDa, which is the GDH enzyme.

Fig. 7

SDS-PAGE analysis of the location and existing state of glycerol dehydrogenase (GDH) expression protein. Lane M—protein marker; lanes 1 and 2—cell lysates from the IPTG-induced E. coli BL21(DE3)pLysS/dhaD strain. Glycerol dehydrogenase (dhaD) protein is indicated by 41 kDa

Batch fermentation by the recombinant E. coli BL21(DE3)pLysS/dhaD strain

The transformed E. coli BL21(DE3)pLysS/dhaD strain was used for biotransformation of glycerol to 2,3-BD. The time course data for the metabolic product, glycerol consumed and cell growth of batch cultivation at 37 °C by E. coli BL21(DE3)pLysS, E. coli BL21(DE3)pLysS/dhaD and K. pneumoniae SRP2 is presented in Fig. 8. The purpose of the culture was both to assess the production of 2,3-BD, glycerol consumption, the efficiency and selectivity of the process. The concentrations of the desired metabolite (2,3-BD) as well as of unused glycerol in the culture medium were analyzed using GC–FID. IPTG was added to the culture medium (MS-2 medium supplemented with 25.0 g/L glycerol) after 6 h. As the GDH activity was increased when the GDH gene was overexpressed, a study of the time course of glycerol metabolism by recombinant E. coli BL21(DE3)pLysS/dhaD, non-recombinant E. coli BL21(DE3)pLysS as well as the wild-type strain K. pneumoniae SRP2 was carried out in shake flasks. The recombinant bacterial strain E. coli BL21(DE3)pLysS/dhaD exhibited 8.97 g/L of 2,3-BD using 24.67 g/L of glycerol after 48 h incubation. This product yield of 2,3-BD is not as high as that of strain K. pneumoniae SRP2 reported in our earlier study (Rahman et al. 2015). The strain E. coli BL21(DE3)pLysS/dhaD might produce metabolic products including 1,3-PDO, ethanol, acetate, succinate or lactate with 2,3-BD (Xu et al. 2014). Therefore, the other two important genes, budB and budC, responsible for 2,3-BD production should be inserted into the glycerol metabolism pathway of E. coli BL21(DE3)pLysS/dhaD stain to get a high yield of 2,3-BD. Although there is no report on the pathway of 2,3-BD production in E. coli, several works have been done on systematic metabolic engineering of E. coli for high product yield of 2,3-BD by introducing budB and budC genes (Xu et al. 2014; Chu et al. 2015).

Fig. 8

Comparison of 2,3-BD product yield, biomass production (cell growth) and glycerol consumed with the strains E. coli BL21(DE3)pLysS (DE3), E. coli BL21(DE3)pLysS/dhaD (DE3/dhaD) and K. pneumoniae SRP2 (SRP2). The incubation temperature and IPTG concentration were 37 °C and 0.5 mM, respectively

We have demonstrated that overexpression of GDH in a E. coli strain led to a significant improvement of GDH activity and 2,3-BD production. The increased GDH activity led to a 2.4-fold increase in 2,3-BD product yield compared with E. coli BL21(DE3)pLysS in a batch biotransformation when 25.0 g/L glycerol was supplied and the reaction time was shortened (Figs. 5a, 8). It is also possible that higher levels of GDH could increase the tolerance of the strain against product(s) inhibition, as suggested by Gätgens et al. (2007). Since in utilized a sufficient amount of glycerol, a relatively low yield of 2,3-BD was attained (Fig. 8a, b), possibly the recombinant strain produced bioproducts other than 2,3-BD due to lack of sufficient activities of other genes in the metabolic pathway of 2,3-BD. Therefore, further improvements in yield will have to construct recombinant strain by introducing budB and budC genes from highly efficient strain, and involve changes in fermentation procedures such as those described by Hekmat et al. (2003) who designed a reactor system consisting of a shaking tank and a permeable column harboring immobilized cells.

The current experiments were carried out with pure glycerol. In a commercial setting, most likely biodiesel-derived glycerol would have to be used. This type of glycerol typically contains various impurities that could cause severe inhibition at high concentrations, or even be toxic to the cells (Sabourin-Provost and Hallenbeck 2009). It remains to be determined if our recombinant strain will be able to provide high yields under those conditions.

Conclusion

A promising strain for industrial production of 2,3-BD was developed by overexpressing the GDH gene in the E. coli BL21(DE3)pLysS strain. Taking advantage of the elevated activity of GDH, the recombinant E. coli BL21(DE3)pLysS/dhaD strain can produce 2,3-BD at an acceptable concentration and display a substantially increased GDH activity when the IPTG inducer is used. The recombinant strain thus has potential for industrial production of 2,3-BD. From these results, the first reported dhaD expression system has paved the way for improvement of 2,3-BD production and is efficient for another heterologous gene expression in E. coli. For further improvement in yield, the recombinant strain could be constructed by introducing budB and budC genes in addition to the dhaD gene from a highly efficient strain.