Skip to main content

Advertisement

Table 1 Strains and plasmids used in this study

From: Efficient 3-hydroxypropionic acid production from glycerol by metabolically engineered Klebsiella pneumoniae

Strains and plasmids Genotype or description Source or references
Strains
 Kp4 Mutant from Klebsiella pneumoniae ATCC10280 by UV Lab collection
 E. coli DH5α Cloning strain Wei et al. (2012)
 E. coli BL21 Cloning strain Lab collection
 JJQ01 Kp4 ΔldhA::apr This study
 JJQ02 Kp4 ΔldhAΔdhaT::apr This study
Plasmids
 pUC18-kan-aldH pUC18-kan carries aldH from E. coli Huang et al. (2012) and (2013)
 pIJ773 Apramycin resistance, carries disruption cassette aac(3)IV Wei et al. (2012)
 pMD18-T-2028/a Ampicillin resistance, carries sequences ldhA::FRT::apr Wei et al. (2012)
 pMD18-T simple Cloning vector Sangon Biotech Co., Ltd.
 pDK6-Red Carries red recombinase gene Wei et al. (2012)
 pDK6-Flp Carries Flp recombinase gene Wei et al. (2012)
 pMD18-T-dhaT Ampicillin resistance, carries gene dhaT This study
 pMD18-T-FRT-aac(3)IV Ampicillin resistance, carries disruption cassette aac(3)IV This study
Primers Sequences (from 5′ to 3′)
ldh-s1 AGAGCGCACAGGACCACTATCCA
ldh-a1 TCGGCGAGCTTATAGACCAGCGT
dhaT-T-F CCATTACCGGCAATAGCGGAACT
dhaT-T-R TCTCGGCCATATTGCGGTCGATA
dhaT-FRT-F1 GCATTATAACCTGAAGCGAGAAGGTATATTATTCCGGGGATCCGTCGACC
dhaT-FRT-R1 AAAGCGACATGACGGCCCCCTCGTTAACACTGTAGGCTGGAGCTGCTTC
FRT-apr-F ATTCCGGGGATCCGTCGACC
FRT-apr-R TGTAGGCTGGAGCTGCTTC
T-F AATATACCTTCTCGCTTCAGGTTATAATGC
T-R GTGTTAACGAGGGGGCCGTCATGTCGCTTT