Skip to main content

Table 2 Primers used in this study

From: Study on a two-component signal transduction system RimA1A2 that negatively regulates oxytetracycline biosynthesis in Streptomyces rimosus M4018

Primers Sequence (5′–3′)
PCR amplification
 DrimF CCCAAGCTTACACCTCGACGATGTTGTTG
 DrimR TGCTCTAGAATACGCGGTCGATGTGGTG
 aprF GTGCAATACGAATGGCGAAAA
 aprR TCAGCCAATCGACTGGCGA
 rim-single-P1 AACCGGTAGTCCGCCGTACGGTG
 rim-single-P2 AGGTTGAGAAGCTGACCGATGAGCTC
 pKANTTF CTAGCTAGCCTCAGTGGAACGAAAACTCAC
 pKANTTR CTAGCTAGCACAATTTCAGGTGGCACTTTTC
 rim-pIBF CGGAATTCCTACGCCACCGGCAGGCGTA
 rim-pIBR GGAATTCCATATGCGCCTGTTGATCGTGGAG
 riml CTACGCCACCGGCAGGCGTAGTTC
 rimR ATGCGCCTGTTGATCGTGGAGGAC
 attLf GTTCACCCACAGCTGGAGGCC
 attLr GCTCGACTTCGCGCTGAAGGT
 attRf GCTATAATGACCCCGAAGCAG
 attRr TCGTCATGCCCCGCAGT
RT-PCR
 co-hrdF GTCCAGGTAGTCGCGCAGGAC
 co-hrdR TCTCGCTGCACACCCCGCTG
 co-rimF GTCGCGATCTGCGTGGCGAC
 co-rimR TGCTGCGCGTGGGAGAGCTG
RT-qPCR
 oxyB-F ACGTCAGCGCGTATCAGTCCTTC
 oxyB-R GCACAGCGAACCGTCCACAC
 otrB-F TTCGCCTTCCTCCAGATGGCGTG
 otrB-R AGCGGTACGTTGAGCAGGAACAC
 otrC-F2 TGCTGTATCTGGACGAGCCGAC
 otrC-R2 GTCGATGACCGTCAGCTCGTG
 otcG-F ATGTCATTCTGCTGGACGGGTC
 otcG-R TCAGAAATCCGCTCACGCGCAG
 otcR-F ATGAAGTCCTTGCGCAGCTGGTAG
 otcR-R CTCCGAAAGTGAAGCAGGTGCTC
 hrdB-F AGAGCGTCGCAGCGAAGAGTC
 hrdB-R CTTCTTGGCGACCGTCTTCTTCTC
  1. Restriction sites are underlined