Skip to main content

Table 1 Primers used in the study

From: Efficient gene deletion and replacement in Aspergillus niger by modified in vivo CRISPR/Cas9 systems

Primer name Sequence (5′–3′)
Cas9-F GCCTGAACTCACCGCGACGTGACTATAAGGACCACGACGG
Cas9-R TCAGTAACGTTAAGTGGATCCTTTTTCTTTTTTGCCTGGC
HindIII-sgRNA-F AACTCACCGCGACGTAAGCTTATGACCCAATACACCGCT
HindIII-sgRNA-R CAGTAACGTTAAGTGACTAGTGACCCAATGTCCCATTCG
hyg-F GTACTGTGTAAGCGCTCCGTCTCCATTGGCTCT
hyg-R GTACTGAGAGTGCAGCAAGGAGATGGCGCCCAA
P1 AACTCACCGCGACGTTTACATCTGATGAGTCCGTGAGGA
P2 CTCAACGGACGCTGTTACATGACGAGCTTACTCGTTTC
P3 ATGTAACAGCGTCCGTTGAGGTTTTAGAGCTAGAAATAGC
P4 CAGTAACGTTAAGTGTCGAGATGACCCAATGT
PU1 AATTCAACCTCAGCCCTA
PU2 TGGCTCTTAATGAGCTGG
PD1 CCTACAGGACACACATTC
PD2 CAAATTCCACAGTCTCGG
  1. The bold letters indicate the protospacer sequences. The underline nucleotide sequences indicate restriction enzyme sites