Skip to main content

Advertisement

Table 3 Primers used in this work

From: Enhanced limonene production by optimizing the expression of limonene biosynthesis and MEP pathway genes in E. coli

Primers Sequences of oligonucleotides (5′–3′)
dxs (s1) GGGAATTCCATATGAGTTTTGATATTGCCAA
dxs (a2) GCGAATTCTTATGCCAGCCAGGCCTTGATTTTG
idi (s) CGGAATTCGAAGGAGATATACATATGCAAACGGAACACGTCATTTTATTG
idi (a) GCGCTCGAGGCTCACAACCCCGGCAAATGTCGG
dxsidiBamHI(s) CGCGGATCCGATGAGTTTTGATATTGCCAA
dxsidiKpnI (a) CGGGGTACCGCTCACAACCCCGGCAAATGTCGG
dxsidiBamH I 1(s) CGCGGATCCATGAGTTTTGATATTGCCAA
LSBamH I(s) CGCGGATCCGATGGAACGTCGTAGCGGTAA
LS(a) CGTAGAATTCTTATGCAAATGGTTCAAACA
GPPS(S) CCGGAATTCGAAGGAGATATACATATGTTCGACTTCAACAAATAC
GPPS(A) ACGCGTCGACTCAGTTCTGACGGAATGCAAC
GPPSBamH I(s) CGCGGATCCGATGTTCGACTTCAACAAATAC
GPPSBamH I 1(s) CGCGGATCCATGTTCGACTTCAACAAATAC
GPPS1(A) CCGGAATTCTCAGTTCTGACGGAATGCAAC
LS1(S) CCGGAATTCGAAGGAGATATACATATGGAACGTCGTAGCGGTAA
LS1 (a) CCGGAATTCTTATGCAAATGGTTCAAACA
S81F-rev AATCATCATGAATTAAAAAGTAAGCGTGGATACAC
S81F-for GTGTATCCACGCTTACTTTTTAATTCATGATGATT
EcFPPSBamHIs CGCGGATCCGATGGACTTTCCGCAGCAACT
EcFPPSEcoRIa CCGGAATTCTTATTTATTACGCTGGATG
LSEcoRISDs CGTAGAATTCAGAAGGAGATATACATATGGAACGTCGTAGCGGTAA
EcFPPSEcoRIs CGTAGAATTCAGAAGGAGATATACATATGGACTTTCCGCAGCAACT
EcFPPSalI ACGCGTCGACTTATTTATTACGCTGGATG
  1. 1:Forward primer;
  2. 2:Reverse primer.