Skip to main content

Table 1 Strains, plasmids, and oligonucleotides used in this study

From: Engineering of Corynebacterium glutamicum for growth and production of L-ornithine, L-lysine, and lycopene from hexuronic acids

Name Relevant genotype/information Reference
E. coli strain   
 DH5α (ф80lacZΔM15) Δ(lacZYA-argF)U169 deoR recA1 endA1 hsdR17(rK−, mK−) supE44 thi1 gyrA96 relA1 [38]
C. glutamicum strains   
 WT Wild-type strain ATCC 13032, auxotrophic for biotin [40]
 ORN1 In-frame deletion of argR and argF, L-ornithine overproducing strain derived from C. glutamicum WT [14]
ATCC 13032, auxotrophic for L-arginine
 DM1933 Δpck deletion mutant of C. glutamicum WT also carrying the chromosomal changes pyc(P458S), hom(V59A), two copies of lysC(T311I), two copies of asd, two copies of dapA, two copies of dapB, two copies of ddh, two copies of lysA, two copies of lysE [37]
 ΔcrtYEb crtY e Y f Eb deletion mutant of C. glutamicum MB001 [23]
Plasmids   
 pEKEx3 SpecR; E. coli/C. glutamicum shuttle vector for regulated gene expression (Ptac, lacI q, pBL1 oriV Cg ) [41]
 pHexA pEKEx3 derivative for IPTG-inducible expression of uxaCAB, uxuAB, kdgK, and eda from E. coli containing artificial ribosome binding sites each This work
 pVWEx1 KmR; E. coli/C. glutamicum shuttle vector for regulated gene expression (Ptac, lacI q, pCG1 oriV Cg ) [42]
 pVWEx1-exuT pVWEx1 derivative for IPTG-inducible expression of exuT from E. coli containing artificial ribosome binding site This work
Primers   
 G1a GCAGGTCGACTCTAGAGGATCCCCGAAAGGAGGCCCTTCAGATGACTCCGTTTATGACTGAAGATTTC
 G1b GTACTAGCTAATGCAATCAGTGATGTTATAGCGTTACGCCGCTTTTG
 G2d CATCACTGATTGCATTAGCTAGTACGAAAGGAGGCCCTTCAGATGAAAACACTAAATCGTCGCGAT
 G2c GCTAATGGTGCTATCTGGTACGATCTTAGCACAACGGACGTACAG
 G3d GATCGTACCAGATAGCACCATTAGCGAAAGGAGGCCCTTCAGATGGAACAGACCTGGCGC
 G3f GCAGGTCGACTCTAGAGGATCCCCATGGAACAGACCTGGCGCTGGTACGGCC
 G3c CGTTCTAGTTACTTTGGAACGTACCTTACAGCGCAGCCACACA
 G4d GGTACGTTCCAAAGTAACTAGAACGGAAAGGAGGCCCTTCAGATGTCCAAAAAGATTGCCGTGAT
 G4c GTCAATCCATGGCATTCTAGCCAAGTTACGCTGGCATCGCCTC
 G5d CTTGGCTAGAATGCCATGGATTGACGAAAGGAGGCCCTTCAGATGAAAAACTGGAAAACAAGTGCAG
 G5c GCCAGTGAATTCGAGCTCGGTACCCTTACAGCTTAGCGCCTTCTACAG
 ExuT-fw CTGCAGGTCGACTCTAGAGGAAAGGAGGCCCTTCAGA
 ExuT-rv CGGTACCCGGGGATCTTAATGTTGCGGTGCGGGATC