Skip to main content

Advertisement

Table 1 Protein production information

From: Sequence similarity network analysis, crystallization, and X-ray crystallographic analysis of the lactate metabolism regulator LldR from Pseudomonas aeruginosa

Source organism Pseudomonas aeruginosa
DNA source Genomic DNA
Forward primer CATATGATGGAATTTGGTCAGGTCAG
Reverse primer GAATTCTTAGTCTTCCTGCACGCTG
Cloning vector pEASY-Blunt
Expression vector pET28a (+)
Expression host Escherichia coli BL21 (DE3)
Complete amino acid sequence of the construct produced MGSSHHHHHHSSGLVPRGSHMEFGQVRQRRLSDDIVAQLEAMILEGTLKSGERLPAERVLAEQFGVSRPSLREAIQKLVAKGLLVSRQGGGNYVTESLGATFSDPLLHLLEGNPEAQRDLLEFRHTLEGSCAYYAALRATSLDHQRLTEAFEALQACYARNDQVSAEEGAADARFHLAIAEASHNTVLLHTIKGLFDLLRRNVVTNIGGMYAQRTETRAQLMEQHQRLYDAIISGQAELAREVSNQHIHYVQEVLAEVQEEARRMKRSQRRRSVQED
  1. NdeI and EcoRI restriction sites were underlined. The extra amino acids added to the wild type PLldR are indicated in italics