Skip to main content

Advertisement

Table 1 Sequence of primers

From: Improving the specific activity and pH stability of xylanase XynHBN188A by directed evolution

PrimerSequence (5′–3′)
HB1GTCAGCGGAAACGATTTATGATAATAGAATAGG
HB2GGCCTTATCGAATCATCAGCTGATTCGTCAT
18N188AFCGCGGATCCGCGGAAACG
18N188ARACGCGTCGACCTTTTATC