Skip to main content

Table 3 Primers used in this work

From: A facile and robust T7-promoter-based high-expression of heterologous proteins in Bacillus subtilis

Primers Oligo sequences (5ʹ → 3ʹ)
Primers used in construction of pHT7-GFP
 P1 gtttaactttaagaaaggaggatataccatgagtaaaggagaagaacttttc
 P2 gctttgttagcagccggatctcattatttgtatagttcatccatgccatg
 P3 catggcatggatgaactatacaaataatgagatccggctgctaacaaagc
 P4 gaaaagttcttctcctttactcaggtatatcctcctttcttaaagttaaac
Primers used in construction of pHT7-αGP
 P5 ctttaagaaaggaggatataccatggtgaacgtttccaatgccgttgaggatg
 P6 cgggctttgttagcagccggatcttagtcaagtcccttccacttgaccagac
 P7 catcctcaacggcattggaaacgttcaccatggtatatcctcctttcttaaag
 P8 gtctggtcaagtggaagggacttgactaagatccggctgctaacaaagcccg
Primers used in construction of pHT7-IMP
 P9 taactttaagaaaggaggatataccatgctggatcgcctggatttctctattaaactgctgcg
 P10 cgggctttgttagcagccggatctcatttaccgccgatttcttcaacaac
 P11 taactttaagaaaggaggatataccatgctggatcgcctggatttctctattaaactgctgcg
 P12 gttgttgaagaaatcggcggtaaatgagatccggctgctaacaaagcccg
Primers used in construction of pHT7-PGM
 P13 ctttaagaaaggaggatataccatggggaagctgtttggaacatttggag
 P14 cgggctttgttagcagccggatcttatgaaagcgctttctcaagtagctc
 P15 gagctacttgagaaagcgctttcataagatccggctgctaacaaagcccg
 P16 ctccaaatgttccaaacagcttccccatggtatatcctcctttcttaaag
Primers used in construction of pHT7-4GT
 P17 ctttaagaaaggaggatataccatggaacgtatcaacttcatcttcggtatcc
 P18 ggctttgttagcagccggatctcacagttcgcgaaaacgaacggtgaattcc
 P19 ggaattcaccgttcgttttcgcgaactgtgagatccggctgctaacaaagcc
 P20 ggataccgaagatgaagttgatacgttccatggtatatcctcctttcttaaag