Antigen-43-mediated surface display revealed in Escherichia coli by different fusion sites and proteins

Materials, strains, plasmids, and gene sources

Bacterial strains, plasmids, and primers are shown in Table 1. Reagents used for plasmids construction including Ex-Taq polymerase, PCR-grade dNTPs, restriction enzymes, T4 ligase, and DNA ladder markers were purchased from Takara (Japan), while Phusion polymerase used for prolonged overlap extension PCR (POE-PCR) was obtained from NEB (USA). All DNA manipulations were performed according to standard protocols. PCR products and restriction-digested DNA were purified using PCR clean-up and gel-extraction kits (GeneDirex, USA). The plasmids were isolated using Plasmid Extraction Mini Kit (Favorgen, Taiwan). Genomic DNA was isolated from 5 mL cells (overnight culture at 37 °C in LB broth) using a bacteria genomic DNA miniprep Kit (Axygen, USA). Recombinant colonies grown on LB plates with appropriate antibiotics were confirmed by colony PCR. All the constructive plasmids were presented in Fig. 1. The gene sequence encoding Ag43 (GenBank: AAT48141.1) was amplified from E. coli MG1655 (ATCC: 47076). The genes encoding the mutant red fluorescent protein (RFP) from Discosoma striata (iGEM: BBa_E1010) and endoglucanase from Bacillus subtilis (BsCel5) (GenBank: CAA97610.1) were amplified using pSB1C3-RFP (iGEM: BBa_J04450) and the Bacillus subtilis genome (ATCC: 23857) as templates, respectively.

Strains and plasmids	Relevant genotypes and descriptions	Source
Strains
E. coli DH5α	F− endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(r K −  m K + ), λ–	Lab stock
E. coli BL21 (DE3)	F– ompT gal dcm lon hsdSB(r B −  m B − ) λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5])	Lab stock
E. coli MG1655	Genomic DNA was prepared for sequence encoding Ag43 PCR-amplification.	Lab stock
Plasmids
pET28a	KanR, f1, pBR322, PT7	Lab stock
pSB1C3-RFP	CmR, pMB1, PlacI, RFP	Lab stock
pET28a-BsCel5	KanR, f1, pBR322, PT7, BsCel5	Lab stock
pET28a-Ag43	KanR, f1, pBR322, PT7, Ag43	This study
pET28a-Ag43-138-RFP	KanR, f1, pBR322, PT7, Ag43-138-RFP	This study
pET28a-Ag43-700-RFP	KanR, f1, pBR322, PT7, Ag43-700-RFP	This study
pET28a-RFP	KanR, f1, pBR322, PT7, RFP	This study
pET28a-Ag43-138-BsCel5	KanR, f1, pBR322, PT7, Ag43-138- BsCel5	This study
pET28a-Ag43-700-BsCel5	KanR, f1, pBR322, PT7, Ag43-700- BsCel5	This study

Primers	Sequence (5′–3′)a
Ag43-MG1655-EcoRI-F	TGGAATTCATGAAACGACATCTGAATACCTGCT
Ag43-MG1655-HindIII-R	AGAAGCTTTCAGAAGGTCACATTCAGTGTGGCCT
Ag43-RFP-IF	CACGTCACTCCCGGTGCTGGCTGCTATGGCTTCCTCCGAAGACGTTATC
Ag43-RFP-138-IR	CAGCCCGTCCCTGAAGGCTCTGTCCAGCACCGGTGGAGTGACGACCTTC
Ag43-RFP-138-VF	GAAGGTCGTCACTCCACCGGTGCTGGACAGAGCCTTCAGGGACGGGCTG
Ag43-RFP-VR	GATAACGTCTTCGGAGGAAGCCATAGCAGCCAGCACCGGGAGTGACGTG
Ag43-RFP-700-IR	CTGCACGATAAGCATTTTCACTGCGAGCACCGGTGGAGTGACGACCTTC
Ag43-RFP-700-VF	GAAGGTCGTCACTCCACCGGTGCTCGCAGTGAAAATGCTTATCGTGCAG
RFP-XhoI-F	GACTCGAGAGCACCGGTGGAGTGACGACCTT
RFP-BamHI-R	CAGGATCCATGGCTTCCTCCGAAGACGTTATC
Ag43-Cel5-IF	CACGTCACTCCCGGTGCTGGCTGCTATGGCAGGGACAAAAACGCCAGTAG
Ag43-Cel5-138-IR	CAGCCCGTCCCTGAAGGCTCTGTCCATTTGGTTCTGTTCCCCAAATCAGT
Ag43-Cel5-138-VF	ACTGATTTGGGGAACAGAACCAAATGGACAGAGCCTTCAGGGACGGGCTG
Ag43-Cel5-VR	CTACTGGCGTTTTTGTCCCTGCCATAGCAGCCAGCACCGGGAGTGACGTG
Ag43-Cel5-700-IR	CTGCACGATAAGCATTTTCACTGCGATTTGGTTCTGTTCCCCAAATCAGT
Ag43-Cel5-700-VF	ACTGATTTGGGGAACAGAACCAAATCGCAGTGAAAATGCTTATCGTGCAG

^aRestriction sites are underlined

Construction plasmids by ligating two digested fragments

Plasmids, pET28a-RFP and pET28a-Ag43, were constructed via DNA manipulation, double restriction-enzyme digestion, purification, ligation, and transformation into E. coli DH5α for plasmid propagation. The Ag43 fragment was digested with EcoRI and HindIII, while RFP fragment was digested with XhoI and BamHI, respectively. The two fragments were ligated into the pET28a which was digested with the same restriction enzymes to obtain plasmids, pET28a-Ag43 and pET28a-RFP, respectively.

Construction of plasmids by POE-PCR

We attempted to construct other plasmids using the method named prolonged overlap extension PCR (POE-PCR) (You and Zhang 2014). In detail, the insertion fragment and the linearized vector with two overlap ends were generated by high-fidelity PCR using NEB Phusion polymerase. Then the multimerization process of purifyng the above two PCR fragments with equimolar DNA was conducted using the method of POE-PCR without adding any primers. The resulting constructed plasmids were directly transformed into E. coli BL21 (DE3). A total of 4 vectors named pET28a-Ag43-138 or pET281-Ag43-700 were also constructed using the method of POE-PCR wherein passenger proteins RFP or BsCel5 are inserted within signal peptides of Ag43 and the C-terminal fragments 138–1039 aa of Ag43 (Fig. 1).

Cultivation conditions and induction

A 1% (v/v) precultured broth was transferred into fresh Luria–Bertani (LB) with 50 μg/mL kanamycin and grown at 37 °C with constant shaking at 200 rpm until OD₆₀₀ nm is equal to 0.6–0.8. Afterward, cells harboring plasmids that used the T7 promoter were induced with 0.1 mM isopropyl β-d-thiogalactoside (IPTG), and the cultivation temperature was decreased to 22 °C for the subsequent 16 h.

The whole-cell protease treatment and SDS-PAGE analysis

The whole-cell protease treatment was originally described by Maurer et al. (1997). Two milliliters of cell culture (OD₆₀₀ nm of 4) was concentrated in a 1.5 mL microcentrifuge tube by centrifugation at 10,000×g for 10 min, and the cell pellet was washed twice with 1 ml phosphate-buffered saline (PBS, pH = 7.4). The cell pellet was resuspended in 950 μL PBS, and 50 μL of 10 g/L trypsin was added. After 60 min of incubation at 37 °C, the reaction was stopped and was followed by washing the cells twice with 1 mL phosphate salt buffer (PBS). The cell pellet was then resuspended in 1 mL PBS. Finally, samples were stored for subsequent SDS-PAGE analysis with 10% (w/v) and 4% (w/v) concentrations as separating and stacking gels, respectively. Tris–glycine buffer (pH 8.3) containing 0.1% SDS was used as electrode buffer. Samples with the same concentration were suspended in protein buffer containing 1% SDS and 5 mM mercaptoethanol, and heated at 100 °C for 10 min before loading onto the gel. Electrophoresis was conducted at a constant current of 20 mA per slab at room temperature in a Biorad mini gel electrophoresis unit. Separated proteins on SDS-PAGE were visualized by staining with Coomassie blue R-250, and then using Image scanner.

Detection of BsCel5 activity on plates using congo red staining

The activity of E. coli strain BL21 (DE3) carrying recombinant BsCel5 can be detected on LB plates containing 10 g/L carboxymethyl cellulose (CMC), 50 μg/mL kanamycin resistance, and 0.1 mM IPTG (Ng et al. 2009). A 2 μL drop of overnight culture was added onto the surface of the CMC-LB plate described above and incubated at 37 °C for 12 h followed by incubation at 55 °C for another 2 h. Plates were then immersed in 2 g/L congo red for 30 min and de-stained by washing twice with 1 M NaCl for total 30 min.

The whole-cell activity assay for BsCel5

The whole-cell activity was done as reported previously with some modifications (Ng et al. 2013). A 300-μL reaction mixture (270 μL of 50 mM sodium acetate buffer (pH 5.5) containing 10 g/L CMC and 30 μL of cell culture (OD₆₀₀ nm of 2) was incubated at 55 °C for 15 min. For thermostability, enzymes were preheated at 55 °C to 80 °C for 1 h. The hydrolysis activity was determined by the reducing sugars released from the reaction, which was measured using the dinitrosalicylic acid (DNS) method (Miller 1959). In brief, the supernatant of the reaction mixtures (200 μL) was mixed with the same volume of DNS reagent and maintained in a boiling water bath for 10 min. The solutions were cooled at room temperature immediately, and color intensity measurement at 540 nm was then performed.

The target proteins fused at the 138th aa and the 700th aa of Ag43

Ag43 is composed of a signal peptide (1–52 aa), a N-terminal unstructured passenger (53–137 aa), a linker (138–600 aa), a putative auto-chaperone (600–700 aa), and a C-terminal β-barrel pore (701–1039 aa) (Fig. 2a) (Ramesh et al. 2012). The signal peptide, which is cleaved and left in the inner membrane, enables Ag43 to reach and fold in the periplasm. Subsequently, the β-barrel domain integrates into the outer membrane where it forms a pore; the passenger domain translocates through this pore to the cell exterior (Kjaergaard et al. 2000). The signal peptide and C-terminal β-barrel pore are necessary in this translocation process, while the other domains would not be replaced. Thus, we constructed two types of plasmids for the fusion of target proteins at two different sites (i.e., the 138th aa and the 700th aa). The plasmid named Ag43-138 inserted a passenger protein through genetic replacement of 53–137 aa and kept the other domains intact, whereas the plasmid named Ag43-700 inserted a passenger protein through genetic replacement of 53–699 aa (Fig. 2b). All the transformants are successful which presented on the surfaces of LB plates (Fig. 3a), as confirmed by PCR and shown in Fig. 3b.

Surface display confirmation by whole-cell trypsin treatment

Trypsin cleaves proteins on the C-terminal side of lysine and arginine amino acid residues. Therefore, by taking advantage of this mechanism, proteins attached to the cell service with extracellular exposure can be removed using trypsin (Maurer et al. 1997). Figure 4a shows the SDS-PAGE analysis for trypsin-treated and untreated whole cells expressing Ag43-138-RFP and Ag43-700-RFP. In contrast to the bands of untreated cells, the SDS-PAGE bands of trypsin-treated cells were much thinner. These data confirmed that cells carrying pET28a-Ag43-138-RFP and pET28a-Ag43-700-RFP both produced surface-displayed RFP. Moreover, cells carrying pET28a-Ag43-138-RFP produced more protein exposed on the cell surface than that of cells carrying pET28a-Ag43-700-RFP.

Whole cells with intracellular BsCel5 (pET28a-BsCel5) showed no differences between trypsin-treated and untreated groups. However, there was an appreciably thinner band in trypsin-treated cells carrying pET28a-Ag43-138-BsCel5 compared with untreated cells; trypsin treatment had no effect on cells carrying pET28a-Ag43-700-BsCel5 (Fig. 4b). Therefore, pET28a-Ag43-138-BsCel5 produced more protein exposed on the cell surface than that of pET28a-Ag43-700-BsCel5, which is in agreement with our RFP results. Thus, the fusion site at the 138th aa was superior to the 700th aa in terms of cell surface display. This finding may be explained by the fact that protein translocation and folding may be enhanced when the proteins are fused at the 138th aa (Ag43-138), as the fragments of 138–1039 aa are unchanged and contain intact linker and auto-chaperone domains.

Can the cell turn red by displaying RFP fused to Ag43?

Fluorescent proteins are used to quickly estimate the efficiency of a display system because they are easily expressed and can be observed from the color of the cell (Kan et al. 2015). As shown in Fig. 3a, RFP expressions are ranking in the order of pET281-Ag43-700-RFP (i.e., 67 kDa) > pET28a-RFP (i.e., 32 kDa) > pET28a-Ag43-138-RFP (i.e., 124 kDa). The protein is soluble (S) in the expression via used pET28a. By surface display in Ag43, proteins are dominating in the pellet (P) or on cell surface which has already proofed by trypsin digestion (Fig. 4). The proteins on the cell surface showed a decreased fluorescence compared to that in the soluble protein. Thus, cell color followed the order of pET28a-RFP > pET28a-700-RFP > pET28a-Ag43-138-RFP (Fig. 3b). RFP expression of pET28a-700-RFP is more than that of pET28a-Ag43-138-RFP, thus cells expressing RFP display deeper red color (Fig. 5). Because the fluorescent protein is easily reduced by the other materials in the extracellular environment and, as a result, loses its fluorescence on the cell surface (Yang et al. 1996).

The cellulase activity of BsCel5 fused to Ag43

BsCel5 was used to estimate the efficiency of our Ag43-mediated surface display system. The obvious hydrolytic zones on CMC-congo red plates are shown for the fusion plasmids (pET28a-Ag43-138-BsCel5 and pET28a-Ag43-700-BsCel5) and for intracellular BsCel5 (pET28a-BsCel5) (Fig. 6A). The hydrolytic zones of intracellular BsCel5 were smaller than those of the surface-displayed BsCel5 on agar plates. Thus, Ag43 is a promising cell display system for cellulases, as BsCel5 on the cell surface that more readily contacted the external environment was more direct than BsCel5 not displayed on the surface. The contact area of an enzyme and its substrate is fixed when the former is displayed on the cell surface, thereby accelerating the interaction between substrates and displayed enzymes.

Whole-cell activity was also measured and is shown in Fig. 6B. The sample of Ag43-138-BsCel5 obtained the highest specific activity, which was 4.65 times of cells containing intracellular BsCel5. On the other hand, the activity of cells containing Ag43-700-BsCel5 was 1.77 times of cells containing intracellular BsCel5. In addition, all the recombinant BsCel5 are thermal stable. At temperatures ranging from 55 to 60 °C, surface-displayed cellulase (pET28a-Ag43-138-BsCel5) shows a higher activity than that of intracellular cellulase (BsCel5). At higher temperatures (up to 79.5 °C), the displayed BsCel5 decreased to 38% residual activity, while BsCel5 preserves 55.2% residual activity (Fig. 6C). It is because the BsCel5 on the cell surface contacted the external environment more directly and became more unstable.

The whole-cell catalyst has been developed by expressing the endoglucanase (Cel5A), exoglucanase (Cel9E), and β-glucosidase (BGL) from Clostridium cellulolyticum on the cell surface of E. coli via the co-displaying by three cellulases fusing with PgsA separately or positional assembly by outer membrane vesicles (OMV) (Ryu and Karim 2011; Park et al. 2012). Moreover, the cellulase was also displayed in another strain, Zymobacter palmae (Kojima et al. 2012). Cellulase-mediated biodegradation of cellulose is one promising approach in global carbon recycling (Ng et al. 2010, 2011), and this biodegradation is also a potential consolidated bioprocessing (CBP) platform for effective production of biocommodities (Arora et al. 2015; Liao et al. 2011; Obeng et al. 2017). Therefore, BsCel5 surface display by Ag43 may be a new approach for whole-cell catalysis and CBP in the future.