Skip to content

Advertisement

Open Access

Characterization and overexpression of a novel keratinase from Bacillus polyfermenticus B4 in recombinant Bacillus subtilis

Bioresources and Bioprocessing20174:47

https://doi.org/10.1186/s40643-017-0177-1

Received: 25 September 2017

Accepted: 11 November 2017

Published: 16 November 2017

Abstract

Background

Keratins, insoluble proteins with a robust structure, are a major component of epidermal tissue and appendages such as hair, feathers, nails, and walls. Keratinous waste mainly emanates from poultry and leather industries, thereby severely contaminating the environment. Keratinase can lyse proteins with robust cross-linked structures, such as keratin, and can hence be used in animal feed, fertilizer, detergent, leather, pharmaceutical, and cosmetic industries. Bacillus polyfermenticus B4, isolated from feather compost, secretes keratinase to metabolize feathers. Hence, this study aimed to investigate the enzymatic characteristics and recombinant production of keratinase from B. polyfermenticus B4.

Methods

A novel keratinase KerP was isolated from B. polyfermenticus B4 and overexpressed in B. subtilis PT5, via the T7 promoter.

Results

The highest keratinolytic activity of recombinant KerP was observed at pH 9.0 and 60 °C. Enzyme activity was enhanced with Fe2+, Mn2+, and SDS, and inhibited by Zn2+, Ni2+, EDTA, PMSF, and β-mercaptoethanol. KerP production was the highest at 473 ± 20 U/mL with B. subtilis aprE signal peptide using LB broth.

Conclusions

The novel keratinase KerP has potential industrial applications, particularly in the treatment of keratinous waste.

Keywords

Keratinase Bacillus polyfermenticus Keratinous wasteCharacterizationOverexpression Bacillus subtilis

Background

Keratin is an essential protein constituent of the animal epidermis and associated integuments such as feathers, hair, nails, scales, horns, and hooves. It is an insoluble protein and can be classified into two types, based on the content of disulfide bonds: soft and hard (Coulombe and Omary 2002). Soft keratin has low disulfide bond content and a soft and flexible texture, and is present in skin and healing tissue, whereas hard keratin has high disulfide bond content and a hard and less flexible texture, and is present in feathers, nails, and horns (Coulombe and Omary 2002). Keratins in the hair or wool primarily contain α-helices, whereas those in feathers or nails primarily contain β-sheets (Onifade et al. 1998; Schrooyen et al. 2001; Wang and Parsons 1997). Cross-linking in keratin fibers occurs through disulfide bonds, hydrogen bonds, and hydrophobic interactions. General proteases such as trypsin and pepsin cannot degrade keratin (Gupta and Ramnani 2006; Kreplak et al. 2004; Olajuyigbe and Falade 2014).

Currently, keratinous wastes from poultry, fur, leather, and slaughter industries are gradually causing serious environmental problems (Korniłłowicz-Kowalska and Bohacz 2011; Onifade et al. 1998). Many attempts have been made to convert keratinous waste to smaller debris or protein hydrolysates through physical and chemical treatments (Gupta et al. 2013), which can then be used as nutrient additives in animal feed, agriculture, and cosmetic industries (Bhange et al. 2016). However, the conventional treatment methods could deteriorate the quality and stability of the hydrolyzed products, adding to environmental concerns such as strong acidification or alkalinization of water through the generated waste.

Keratinases are proteases that can particularly lyse recalcitrant proteins such as keratin (Onifade et al. 1998). Keratinases have been reported in many microorganisms such as bacteria, actinomycetes, and fungi (Bhange et al. 2016). Moreover, KerA, isolated from Bacillus licheniformis PWD-1, is the most well-characterized keratinase (Lin et al. 1995; Onifade et al. 1998). Keratinases bind to and cleave keratins at their hydrophobic sites. Based on their catalytic mechanism, most keratinases are either metalloproteases or serine-metalloproteases (Brandelli 2008; Bressollier et al. 1999).

Microorganisms isolated from keratin-rich environments such as poultry feather wastes, slaughterhouse wastes, and leather wastes, have high keratinolytic activity (Brandelli et al. 2010; Fakhfakh-Zouari et al. 2010; Khardenavis et al. 2009). Most of the keratinases from these strains are extracellular enzymes, with only a minute fraction being intracellular or associated with the cell wall. Because of their unique characteristics, keratinases have potential applications in industrial fields such as stock farming, poultry feather treatment, leather depilation, laundry detergents, and cosmetics. However, large-scale production of keratinase is essential for its application at the industrial level.

Previous studies have used various bacterial expression systems for keratinase production (Lin et al. 1997; Liu et al. 2014; Radha and Gunasekaran 2008). Bacillus subtilis can efficiently secrete native or heterologous proteins into the culture broth, which renders it an attractive strain for enzyme production at an industrial level. Moreover, B. subtilis is a generally recognized as safe (GRAS) bacterium, with promising application in protein requirement in food and in the clinical setting (de Boer Sietske and Diderichsen 1991; Harwood 1992; Pohl and Harwood 2010; Schallmey et al. 2004; Westers et al. 2004). Signal peptides play a very important role in protein secretion in B. subtilis (Brockmeier et al. 2006; Tjalsma et al. 2004); a suitable signal peptide could significantly enhance target protein secretion (Brockmeier et al. 2006; Li et al. 2004).

In this study, a keratinolytic bacterium Bacillus polyfermenticus B4 was isolated from soil feather composts in a chicken farm in Tainan and a novel keratinase KerP was isolated and cloned into B. subtilis PT5 for heterologous production. Furthermore, the biochemical characteristics and catalytic mechanism of KerP were investigated. Moreover, enzyme production in B. subtilis was evaluated by fusing the mature KerP polypeptide with different signal peptides.

Methods

Isolation and screening of keratinolytic microorganisms from feather composts

To isolate keratinolytic microorganisms, soil samples from feather composts were extracted from six areas (sample A to F) of a poultry farm in Tainan, Taiwan. Each 5-g sample was suspended in 100 mL feather defined medium (defined medium containing 10 g of feathers) in a 500-mL shake flask and incubated at 37 °C at 150 rpm. After 2 days of incubation, the feathers were disrupted in the culture medium containing sample B, and after 12 days of culturing, the feathers were decomposed to small debris, except for some broken rachis. Thereafter, 0.1 mL of diluted culture broth (10−6) containing sample B was spread on a plate containing defined medium and 1% skimmed milk. The halo-forming colonies thus formed were considered potential candidates for keratinase production, and inoculated into feather defined medium at 37 °C at 150 rpm. Furthermore, 16S rDNA sequencing was performed with primers 27F and 1497R (Kim et al. 2000) to identify the microorganisms.

Bacterial strains and culture conditions

The bacterial strains used in this study are listed in Table 1. Gene cloning was performed in E. coli DH5α and B. subtilis strain PT5 containing the T7 RNA polymerase for gene expression driven by the T7 promoter (Chen et al. 2010). For DNA manipulation, E. coli were grown in 10 mL of Luria–Bertani (LB) medium in a 125-mL shake flask, and cell densities were determined through the optical density at 600 nm (OD600). For keratinase production, recombinant B. subtilis strains were cultured overnight at 37 °C and inoculated into a 250-mL shake flask containing fresh LB medium (30 mL) with cell density of OD600 = 0.1, and then incubated in an orbital shaker at 200 rpm and 37 °C for 24 h. For the selection of E. coli harboring plasmids or B. subtilis integrants, the medium was supplanted with antibiotics ampicillin (50 µg/L for E. coli) and erythromycin (10 µg/L for B. subtilis).
Table 1

Strains and plasmids used in this study

 

Relevant characteristics

Source

Strain

E. coli

 DH5α

deoR endA1 gyrA96 hsdR17 supE44 thi1 recA1 lacZM15

Lab. collection

B. subtilis

 PT5

DB428, wpr::T7gene 1

 

 PT5(DMT-KerP)

PT5, mpr:: PT7/kerP-erm

This study

 PT5(DMT1-mKerP)

PT5, mpr:: PT7/aprE SP-mkerp-erm

This study

 PT5(DMT7-mKerP)

PT5, mpr:: PT7/xynD SP-mkerp-erm

This study

 PT5(DMT8-mKerP)

PT5, mpr:: PT7/bglS SP-mkerp-erm

This study

 PT5(DMT12-mKerP)

PT5, mpr:: PT7/mpr SP-mkerp-erm

This study

 PT5(DMT16-mKerP)

PT5, mpr:: PT7/xynA SP-mkerp-erm

This study

 PT5(DMT21-mKerP)

PT5, mpr:: PT7/abnA SP-mkerp-erm

This study

Plasmid

 pDMT

Integration vector contains by PT7 and mpr′

 

 pDMT-KerP

pDMT with full-length kerP gene

This study

 pDMT1-mKerP

aprE SP instead of kerP SP in pDMT-KerP

This study

 pDMT7-mKerP

xynD SP instead of kerP SP in pDMT-KerP

This study

 pDMT8-mKerP

bglS SP instead of kerP SP in pDMT-KerP

This study

 pDMT12-mKerP

mpr SP instead of kerP SP in pDMT-KerP

This study

 pDMT16-mKerP

xynA SP instead of kerP SP in pDMT-KerP

This study

 pDMT21-mKerP

abnA SP instead of kerP SP in pDMT-KerP

This study

erm, selection marker of erythromycin resistant; kerp, keratinase KerP full-length gene; mkerP, keratinase KerP mature sequence; PT7, T7 promoter; SP, signal peptide

Construction of expression vectors for keratinase secretion

The vectors and primers used in this study are listed in Tables 1 and 2, respectively. The full-length keratinase gene kerP was amplified from B. polyfermenticus B4 through polymerase chain reaction (PCR) with primers KP01 and KP02. The PCR product of kerP (0.802 kb) was digested with NruI/BamHI and ligated with the integration vector pDMT to generate pDMT-KerP.
Table 2

Primers used in this study

 

Relevant characteristics

Source

Primer

 27F

AGAGTTTGATCCTGGCTCAG

 

 1492R

AAGTCGTAACAAGGTAACC

 

 BP01

GTGAGAGGCAAAAAGGTATG

 

 BP02

TTACTGAGCTGCCGCCTG

 

 KP01

ATCGTATCGCGAGTGAGAGGCAAAAAGGTATG (NruI)

 

 KP02

CTATGAGGATCCTTACTGAGCTGCCGCCTG (BamHI)

 

 DMKP01

TGACTATCGCGATTACCCTCTCCTTTTAAAAAATC (NruI)

 

 DMKP02

TATGCTCTCGAGGGCAGGGAAATCAAACGGGGA (XhoI)

 

 aprE01

AGAGGGTCGCGAGTGAGAAGCAAAAAATTGTGG (NruI)

aprE SP

 aprE02

GATCGACTCGAGGCAGCCTGCGCAGACATGTTG (XhoI)

aprE SP

 xynD01

ATGCATTCGCGAATGAGGAAAAAGTGTAGCGT (NruI)

xynD SP

 xynD02

TAGCTACTCGAGGCAGCATACGCAGACTTCCCAG (XhoI)

xynD SP

 bglS01

ATGCATTCGCGAATGCCTTATCTGAAACGAGTG (NruI)

bglS SP

 bglS02

TAGCTACTCGAGGCAGCTGAGGCAGTAGCAGTGA (XhoI)

bglS SP

 mpr01

GGAAGTTCGCGAATGAAATTAGTTCCAAGATTCAG (NruI)

mpr SP

 mpr02

TAGCTACTCGAGGCCGCTTTTGCCGGTACGCCA (XhoI)

mpr SP

 xynA01

ATGCATTCGCGAATGTTTAAGTTTAAAAAGAATTTC (NruI)

xynA SP

 xynA02

TAGCTACTCGAGGCTGCAGAGGCGGTTGCCGAA (XhoI)

xynA SP

 abnA01

GATGACTCGCGAATGAAAAAGAAAAAAACATGG (NruI)

abnA SP

 abnA02

TAGCTACTCGAGGCTGCCTCTGCGGGAGCAG (XhoI)

abnA SP

The PCR product of DMT-mKerP0102 (5.033 kb) was amplified from vector pDMT-KerP designed to eliminate the kerP signal peptide sequence, which was amplified by PCR with primers DMKP01 and 02 and plasmid pDMT-KerP as a template. Six signal sequences were amplified from the B. subtilis chromosome, using specific primer pairs. The PCR products of signal sequences were digested with XhoI/BamHI and cloned into the PCR product DMT-mKerP0102 to generate the six integration vectors (Table 1).

Polymerase chain reaction was carried out using Q5 DNA polymerase (New England BioLabs) per the following protocol: pre-denaturation at 98 °C for 30 s, 25–30 cycles of DNA amplification during amplification 98 °C for 10 s, annealing at 60 °C for 10 s, elongation at 2 kb/min at 72 °C; and a final extension step at 72 °C for 5 min. The generated vectors were integrated into B. subtilis PT5 chromosome through double homologous recombination to generate KerP-producing strains.

Analytical methods

The keratinolytic activity assay protocol developed previously (Vermelho et al. 2010) was performed in this study, with minor modifications. The 0.1-mL cell-free culture broth was added to a 0.4-mL reaction mixture containing 0.05 M Glycine–NaOH buffer (pH 9.0) and 10-mg feather powder (purchased from an agricultural materials store in Tainan, Taiwan). The reaction was carried out at 60 °C for 1 h and terminated by adding 20% trichloroacetic acid (0.5 mL). After centrifugation for 10 min at 4 °C, 14,000 rpm, the optical density of the supernatant was determined at 280 nm. One unit of keratinolytic activity (one unit) was defined as the amount of enzyme required to increase the A 280 by 0.01.

The cell-free culture broth was harvested through centrifugation for 10 min at 4 °C, 14,000 rpm for evaluating keratinase activity or production via SDS-PAGE on a 10% (w/v) polyacrylamide gel, as described previously (Chao et al. 2002).

Temperature and pH dependence

The optimal pH and temperature for KerP activity were determined using buffers of pH 5–12 at 30–90 °C. Different buffers were selected to cover a range of pH value by using Mcilvaine (pH 5–6), Tris–HCl (pH 7–8), and Glycine–NaOH (pH 9–12) buffers. Enzyme activity was analyzed as described above. To estimate the pH stability of KerP, the enzyme was incubated for different durations at 4 °C. The thermal stability was determined by measuring the residual activity of the enzyme solution incubated at 30–90 °C for 10–60 min.

Batch fermentation

A 5-L fermenter was used for batch fermentation of recombinant B. subtilis. After overnight fermentation, the cell culture was inoculated into three 500-mL shake flasks containing 200 mL fresh LB medium, with the initial cell density adjusted to 0.1 (OD600). After 2 h of culturing, cultures from the three shake flasks were transferred into the fermenter. The final volume in the fermenter was adjusted to 3 L and the initial cell density was adjusted at 0.1 (OD600). The working condition was set at 37 °C; initial pH, 7.0; air flow, 1.5 vvm; and dissolved oxygen concentration (maintained through agitation), 20%.

Results and discussion

Isolation and screening of keratinolytic microorganisms from feather composts

After 12 days of culturing in the feather meal medium, complete decomposition of feathers was observed only in flask B4. The results indicated that only the B4 strain could produce keratinase, while the other strains produced general proteases. Furthermore, 16S rDNA sequencing (Kim et al. 2000) performed using strain B4, followed by sequence analysis by National Center for Biotechnology Information (NCBI) indicated that B4 strain showed 99.8% sequence similarity to B. polyfermenticus. Hence, the B4 strain was identified as B. polyfermenticus B4.

Keratinase isolation from B. polyfermenticus B4 and production of recombinant keratinase

The protein sequence of the commercially available keratinase KerA from B. licheniformis PWD-1 (Lin et al. 1995) was compared with that of B. polyfermenticus through a protein BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome). KerA showed 65% similarity to alkaline protease precursor (GeneBank: ADP23919.1), using the protein database of B. polyfermenticus. This suggested that the alkaline protease precursor of B. polyfermenticus maybe attributed to keratinase and also existed in B. polyfermenticus B4. Two primers, BP01 and BP02, were designed for B. polyfermenticus SCN11 alkaline protease precursor (GeneBank: HQ436407.1). The single DNA fragment BP0102 was amplified through PCR with primers BP01–BP02 and B. polyfermenticus B4 chromosome as a template. The PCR product BP0102 was cloned into the plasmid pBluescript II SK(−) digested with EcoRV to generate pBlue-BP0102, which was then subjected to DNA sequencing (Tri-I Biotech, Inc., New Taipei City) with T7 and T3 primers. The DNA fragment was translated to the corresponding polypeptide in silico and a BLASTX was performed to compare the translated sequence with alkaline protease precursor protein. The result was showed in Additional file 1: Figure S1 revealed a 99% similarity with alkaline protease precursor (GeneBank: ADP23919.1). Therefore, this gene fragment was putatively referred to as KerP.

The KerP gene was amplified through PCR with primers KP01 and KP02 and then cloned into the integrant plasmid pDMT to generate pDMT-KerP, using NruI and BamHI. The plasmid pDMT-KerP was integrated into the B. subtilis PT5 chromosome, resulting in the new KerP-expressing strain PT5(DMT-KerP). This strain formed a clear halo in the LB plate containing skim milk. Moreover, this recombinant strain could digest the feathers completely in feather defined medium after 7 days of incubation. This proved that the kerP gene encodes a keratinase.

Effect of pH and temperature on KerP activity

With feather powder as the substrate, the highest KerP activity was observed at pH 9.0, (Fig. 1a) and the enzyme retained complete activity at pH 7–8 after 48 h of storage at 4 °C. However, enzyme activity was less than 50% after 48 h at pH 5, 11, 12 (Fig. 1b). The results showed that the optimal pH is 9.0 but the enzyme is stable at pH 7–8.
Fig. 1

a Effect of pH on KerP activity. b pH stability of KerP. Enzyme activity was preserved at various pH levels between 0 and 48 h before assaying enzyme activity. pH 5.0 (filled circle), pH 6.0 (open circle), pH 7.0 (filled inverted triangle), pH 8.0 (open triangle), pH 9.0 (filled square), pH 10.0 (open square), pH 11.0 (filled diamond), pH 12.0 (open diamond). The enzyme activity was assayed with feather powders as the substrate at 60 °C for 1 h

On incubation at pH 9.0, KerP exhibited the maximum activity at 60 °C (Fig. 2a). Enzyme activity was relatively stable below 60 °C after 60 min of pretreatment and declined rapidly beyond 80 °C (Fig. 2b). The optimal pH and temperature of the commercial keratinase KerA from B. licheniformis PWD-1 were pH 7.5 and 50 °C, respectively. Keratinase KerP is similar to other bacterial keratinases in optimal conditions (Sangali and Brandelli 2000; Sookkheo et al. 2000; Zhang et al. 2016). Moreover, the stability of KerP suggested potential industrial applications.
Fig. 2

a Effect of temperature on KerP activity. b Temperature stability of KerP. Enzyme activity was preserved at various temperatures between 0 and 60 min before assaying enzyme activity. 30 °C (filled circle), 40 °C (open circle), 50 °C (filled inverted triangle), 60 °C (open triangle), and 70 °C (filled square) for 60 min. The enzyme activity was assayed with feather powders as the substrate at pH 9.0 for 1 h

Effects of chemical compounds on KerP activity

The effects of metal ions, inhibitors, and surfactants on KerP activity were investigated (Table 3). Enzyme activity was enhanced by Fe2+ and SDS but significantly inhibited by Ni2+, Zn2+, EDTA, PMSF, and β-mercaptoethanol. Because KerP was strongly inhibited by EDTA (relative activity 47%) and PMSF (relative activity 8%), it may be a serine protease or a serine-metalloproteinase (Brandelli 2008). Moreover, the detergent SDS enhanced the enzyme activity by 2.79 folds, thereby suggesting that KerP could resist the detergent and that the detergent could increase the surface contact between the feathers and the enzyme. Compared to other keratinases (Su et al. 2017a; Zhang et al. 2016), KerP has higher potential for application in commercial cleaning or bath products that contain SDS.
Table 3

Effect of chemicals on KerP activity

Chemicals

Concentrations

Relative activity (%)

Control

100 ± 2

CaCO3

10 mM

125 ± 2

MgSO4

10 mM

151 ± 1

MnSO4

10 mM

158 ± 2

FeSO4

10 mM

308 ± 2

ZnSO4

10 mM

60 ± 1

NiSO4

10 mM

15 ± 1

EDTA

1 mM

47 ± 1

PMSF

1 mM

8 ± 1

SDS

1%

279 ± 2

β-mercaptoethanol

1%

31 ± 1

Triton X-100

1%

109 ± 5

Tween-80

1%

100 ± 1

Enhancement of the KerP secretion in B. subtilis

Various bacterial expression systems were utilized for keratinase production, and B. subtilis was a better and more efficient host for keratinase production (Haddar et al. 2009; Lin et al. 1997; Liu et al. 2014; Zaghloul et al. 2011). All of them used the expression vectors to heterologously produce keratinase in B. subtilis. However, the expression plasmid used in B. subtilis would lead to problems of plasmid instability, which could reduce enzyme production, thereby interfering with enzyme production at the industrial level. The segregational and structural instability of B. subtilis plasmids are the two major, clearly described problems (Chen et al. 2007). To overcome these problems, researchers used theta mode plasmids that provide complete structural stability to express the enzyme. However, this type of plasmid still has the problem of segregational instability. The segregational instability of B. subtilis plasmids can be stabilized through the addition of selection marker (antibiotics or the deficiency components of amino acids) in the culture medium; however, this would increase the cost of fermentation and affect the environment in the industrial fermentation process. For industrial enzyme production, strain stability is critical for mass production of proteins of interest. Moreover, the enhancement of secretion of the recombinant protein is also a pivotal point in the B. subtilis expression system. For secretion, proteins need to be guided by the signal peptide. The appropriate signal peptide could enhance the secretion efficiency even though the original signal peptide may not be the best signal peptide (Chen et al. 2015). Therefore, screening of the signal peptide must be considered during the construction of the expression vector for the host.

The signal peptide sequence of KerP was compared with those in a B. subtilis database in our laboratory, and six different signal peptide candidates were amplified through PCR and replaced with the KerP original signal peptide on the vector pDMT-BpKer to increase keratinase secretion. The vectors were integrated into the B. subtilis PT5 chromosome to determine the keratinolytic activity of KerP. Results showed that the keratinase production was greater in three strains, PT5(DMT01-mKerP), PT5(DMT06-mKerP), and PT5(DMT12-mKerP), than in PT5(DMT-KerP) (Fig. 3). The highest production of KerP (473 ± 20 U/mL) was observed in PT5(DMT01-mKerP); its keratinase production was 1.55 times that of PT5(DMT-KerP), which used the original signal peptide of KerP, thereby indicating that the original signal peptide of KerP from B. polyfermenticus B4 could not result in the highest production of KerP in B. subtilis.
Fig. 3

Production of KerP by recombinant B. subtilis. Lanes: 1, PT5; 2, PT5(DMT-KerP); 3, PT5(DMT01-mKerP); 4, PT5(MT07-mKerP); 5, PT5(DMT08-mKerP); 6, PT5(DMT12-mKerP); 7, PT5(DMT16-mKerP); 8, PT5(MT21-mKerP)

Batch fermentation of KerP-producing B. subtilis

Batch fermentation of PT5(DMT1-mKerP) was executed in a 5-L fermenter for producing KerP. Because of the characteristics of B. subtilis (Chen et al. 2007; Su et al. 2017b), the pH was not regulated during fermentation. KerP production was gradually increased with an increase in fermentation time. Keratinolytic activity was 467 ± 26 U/L (81.7 ± 5.6 mg/L) after 24 h of fermentation (Fig. 4a and b). The enzyme production through fermentation was similar to that through shake flask cultivation. Compared with that in previous studies (Chen et al. 2007, 2015; Su et al. 2017b), the yield of keratinase was the highest when using LB broth as the fermentation medium.
Fig. 4

a Batch fermentation of recombinant KerP-producing strain PT5(DMT01-mKerP) in a 5-L fermenter. Cell density was determined during fermentation (closed circles) at OD600, and the production of KerP was assayed through measurement of keratinolytic activity (open circles). b SDS-PAGE analysis of KerP secreted by recombinant B. subtilis PT5(DMT01-mKerP). Fifteen microliters of culture broth from different fermentation periods was drawn out for PAGE. Lanes M, protein marker; lane 1, the culture broth of PT5 after 24-h fermentation; the culture broth of strain PT5(DMT01-mKerP) after fermentation for lane 2, 3 h; lane 3, 6 h; lane 4, 9 h; lane 5, 12 h; lane 6, 15 h; lane 7, 18 h; lane 8, 21 h; and lane 9, 24 h. The arrow indicates the position of KerP

Conclusions

The keratinolytic strain B. polyfermenticus B4 was isolated from a poultry farm in Tainan, Taiwan, and its keratinase KerP was successfully cloned and expressed in B. subtilis PT5. Biochemical analysis revealed that the maximum keratinolytic activity of recombinant KerP was achieved at pH 9.0 and 60 °C. Enzyme activity could be enhanced with Fe2+, Mn2+, and SDS, and inhibited by Zn2+, Ni2+, EDTA, PMSF, and β-mercaptoethanol. The highest production of KerP was possible with the use of B. subtilis aprE signal peptide (Fig. 4a and b). KerP has potential applications in industry and in the treatment of keratinolytic waste. Future studies are required to standardize media composition and investigate scale-up fermentation strategies.

Abbreviations

erm: 

selection marker of erythromycin resistant

kerp

keratinase KerP full-length gene

mkerP

keratinase KerP mature sequence

PT7

T7 promoter

SP: 

signal peptide

Declarations

Authors’ contributions

PT designed the experiments, analyzed the data, and wrote the manuscript. YZ conducted most of the experiments, and WS provided the experimental materials and performed a few experiments. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

All data generated or analyzed during this study are included in the main manuscript file.

Consent for publication

The authors approved the consent for publishing the manuscript.

Ethics approval and consent to participate

All authors have read and agreed the ethics for publishing the manuscript.

Funding

Funding information is not applicable.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors’ Affiliations

(1)
Department of Biotechnology, Southern Taiwan University of Science and Technology, Tainan, Taiwan
(2)
Net-Bio Biotechnology Enterprise Co., LTD, Tainan, Taiwan

References

  1. Bhange K, Chaturvedi V, Bhatt R (2016) Ameliorating effects of chicken feathers in plant growth promotion activity by a keratinolytic strain of Bacillus subtilis PF1. Bioresour Bioprocess 3(1):13View ArticleGoogle Scholar
  2. Brandelli A (2008) Bacterial keratinases: useful enzymes for bioprocessing agroindustrial wastes and beyond. Food Bioprocess Technol 1(2):105–116View ArticleGoogle Scholar
  3. Brandelli A, Daroit DJ, Riffel A (2010) Biochemical features of microbial keratinases and their production and applications. Appl Microbiol Biotechnol 85(6):1735–1750View ArticleGoogle Scholar
  4. Bressollier P, Letourneau F, Urdaci M, Verneuil B (1999) Purification and characterization of a keratinolytic serine proteinase from Streptomyces albidoflavus. Appl Environ Microbiol 65(6):2570–2576Google Scholar
  5. Brockmeier U, Caspers M, Freudl R, Jockwer A, Noll T, Eggert T (2006) Systematic screening of all signal peptides from Bacillus subtilis: a powerful strategy in optimizing heterologous protein secretion in Gram-positive bacteria. J Mol Biol 362(3):393–402View ArticleGoogle Scholar
  6. Chao YP, Chiang CJ, Hung WB (2002) Stringent regulation and high-level expression of heterologous genes in Escherichia coli using T7 system controllable by the araBAD promoter. Biotechnol Prog 18(2):394–400View ArticleGoogle Scholar
  7. Chen PT, Chiang CJ, Chao YP (2007) Strategy to approach stable production of recombinant nattokinase in Bacillus subtilis. Biotechnol Prog 23(4):808–813View ArticleGoogle Scholar
  8. Chen PT, Shaw J-F, Chao Y-P, David Ho T-H, Yu S-M (2010) Construction of chromosomally located T7 expression system for production of heterologous secreted proteins in Bacillus subtilis. J Agric Food Chem 58(9):5392–5399View ArticleGoogle Scholar
  9. Chen PT, Chen Y-C, Lin Y-Y, Su H-H (2015) Strategy for efficient production of recombinant Staphylococcus epidermidis lipase in Bacillus subtilis. Biochem Eng J 103:152–157View ArticleGoogle Scholar
  10. Coulombe PA, Omary MB (2002) ‘Hard’ and ‘soft’ principles defining the structure, function and regulation of keratin intermediate filaments. Curr Opin Cell Biol 14(1):110–122View ArticleGoogle Scholar
  11. de Boer Sietske A, Diderichsen B (1991) On the safety of Bacillus subtilis and B. amyloliquefaciens: a review. Appl Microbiol Biotechnol 36(1):1–4View ArticleGoogle Scholar
  12. Fakhfakh-Zouari N, Haddar A, Hmidet N, Frikha F, Nasri M (2010) Application of statistical experimental design for optimization of keratinases production by Bacillus pumilus A1 grown on chicken feather and some biochemical properties. Process Biochem 45(5):617–626View ArticleGoogle Scholar
  13. Gupta R, Ramnani P (2006) Microbial keratinases and their prospective applications: an overview. Appl Microbiol Biotechnol 70(1):21View ArticleGoogle Scholar
  14. Gupta R, Rajput R, Sharma R, Gupta N (2013) Biotechnological applications and prospective market of microbial keratinases. Appl Microbiol Biotechnol 97(23):9931–9940View ArticleGoogle Scholar
  15. Haddar HO, Zaghloul TI, Saeed HM (2009) Biodegradation of native feather keratin by Bacillus subtilis recombinant strains. Biodegradation 20(5):687View ArticleGoogle Scholar
  16. Harwood CR (1992) Bacillus subtilis and its relatives: molecular biological and industrial workhorses. Trends Biotechnol 10:247–256View ArticleGoogle Scholar
  17. Khardenavis AA, Kapley A, Purohit HJ (2009) Processing of poultry feathers by alkaline keratin hydrolyzing enzyme from Serratia sp. HPC 1383. Waste Manag 29(4):1409–1415View ArticleGoogle Scholar
  18. Kim S-J, Chun J, Bae KS, Kim Y-C (2000) Polyphasic assignment of an aromatic-degrading Pseudomonas sp., strain DJ77, in the genus Sphingomonas as Sphingomonas chungbukensis sp. nov. Int J Syst Evol Microbiol 50(4):1641–1647View ArticleGoogle Scholar
  19. Korniłłowicz-Kowalska T, Bohacz J (2011) Biodegradation of keratin waste: theory and practical aspects. Waste Manag 31(8):1689–1701View ArticleGoogle Scholar
  20. Kreplak L, Doucet J, Dumas P, Briki F (2004) New aspects of the α-helix to β-sheet transition in stretched hard α-keratin fibers. Biophys J 87(1):640–647View ArticleGoogle Scholar
  21. Li W, Zhou X, Lu P (2004) Bottlenecks in the expression and secretion of heterologous proteins in Bacillus subtilis. Res Microbiol 155(8):605–610View ArticleGoogle Scholar
  22. Lin X, Kelemen DW, Miller ES, Shih J (1995) Nucleotide sequence and expression of kerA, the gene encoding a keratinolytic protease of Bacillus licheniformis PWD-1. Appl Environ Microbiol 61(4):1469–1474Google Scholar
  23. Lin X, Wong S, Miller E, Shih J (1997) Expression of the Bacillus licheniformis PWD-1 keratinase gene in B. subtilis. J Ind Microbiol Biotechnol 19(2):134–138View ArticleGoogle Scholar
  24. Liu B, Zhang J, Gu L, Du G, Chen J, Liao X (2014) Comparative analysis of bacterial expression systems for keratinase production. Appl Biochem Biotechnol 173(5):1222–1235View ArticleGoogle Scholar
  25. Olajuyigbe FM, Falade AM (2014) Purification and partial characterization of serine alkaline metalloprotease from Bacillus brevis MWB-01. Bioresour Bioprocess 1(1):8View ArticleGoogle Scholar
  26. Onifade A, Al-Sane N, Al-Musallam A, Al-Zarban S (1998) A review: potentials for biotechnological applications of keratin-degrading microorganisms and their enzymes for nutritional improvement of feathers and other keratins as livestock feed resources. Bioresour Technol 66(1):1–11View ArticleGoogle Scholar
  27. Pohl S, Harwood CR (2010) Heterologous protein secretion by Bacillus species: from the cradle to the grave. Adv Appl Microbiol 73:1–25View ArticleGoogle Scholar
  28. Radha S, Gunasekaran P (2008) Sustained expression of keratinase gene under PxylA and PamyL promoters in the recombinant Bacillus megaterium MS941. Bioresour Technol 99(13):5528–5537View ArticleGoogle Scholar
  29. Sangali S, Brandelli A (2000) Isolation and characterization of a novel feather-degrading bacterial strain. Appl Biochem Biotechnol 87(1):17–24View ArticleGoogle Scholar
  30. Schallmey M, Singh A, Ward OP (2004) Developments in the use of Bacillus species for industrial production. Can J Microbiol 50(1):1–17View ArticleGoogle Scholar
  31. Schrooyen PM, Dijkstra PJ, Oberthür RC, Bantjes A, Feijen J (2001) Partially carboxymethylated feather keratins. 2. Thermal and mechanical properties of films. J Agric Food Chem 49(1):221–230View ArticleGoogle Scholar
  32. Sookkheo B, Sinchaikul S, Phutrakul S, Chen S-T (2000) Purification and characterization of the highly thermostable proteases from Bacillus stearothermophilus TLS33. Protein Expr Purif 20(2):142–151View ArticleGoogle Scholar
  33. Su C, Gong J-S, Zhang R-X, Tao L-Y, Dou W-F, Zhang D-D, Li H, Lu Z-M, Xu Z-H, Shi J-S (2017a) A novel alkaline surfactant-stable keratinase with superior feather-degrading potential based on library screening strategy. Int J Biol Macromol 95:404–411View ArticleGoogle Scholar
  34. Su P-C, Hsueh W-C, Chang W-S, Chen PT (2017b) Enhancement of chitosanase secretion by Bacillus subtilis for production of chitosan oligosaccharides. J Taiwan Inst Chem Eng 79:49–54View ArticleGoogle Scholar
  35. Tjalsma H, Antelmann H, Jongbloed JD, Braun PG, Darmon E, Dorenbos R, Dubois J-YF, Westers H, Zanen G, Quax WJ (2004) Proteomics of protein secretion by Bacillus subtilis: separating the “secrets” of the secretome. Microbiol Mol Biol Rev 68(2):207–233View ArticleGoogle Scholar
  36. Vermelho AB, Mazotto AM, de Melo ACN, Vieira FHC, Duarte TR, Macrae A, Nishikawa MM, da Silva Bon EP (2010) Identification of a Candida parapsilosis strain producing extracellular serine peptidase with keratinolytic activity. Mycopathologia 169(1):57View ArticleGoogle Scholar
  37. Wang X, Parsons C (1997) Effect of processing systems on protein quality of feather meals and hog hair meals. Poult Sci 76(3):491–496View ArticleGoogle Scholar
  38. Westers L, Westers H, Quax WJ (2004) Bacillus subtilis as cell factory for pharmaceutical proteins: a biotechnological approach to optimize the host organism. Biochim Biophys Acta 1694(1):299–310View ArticleGoogle Scholar
  39. Zaghloul TI, Embaby AM, Elmahdy AR (2011) Key determinants affecting sheep wool biodegradation directed by a keratinase-producing Bacillus subtilis recombinant strain. Biodegradation 22(1):111–128View ArticleGoogle Scholar
  40. Zhang R-X, Gong J-S, Su C, Zhang D-D, Tian H, Dou W-F, Li H, Shi J-S, Xu Z-H (2016) Biochemical characterization of a novel surfactant-stable serine keratinase with no collagenase activity from Brevibacillus parabrevis CGMCC 10798. Int J Biol Macromol 93:843–851View ArticleGoogle Scholar

Copyright

© The Author(s) 2017

Advertisement