- Research
- Open access
- Published:
Expression of recombinant human Apolipoprotein A-IMilano in Nicotiana tabacum
Bioresources and Bioprocessing volume 10, Article number: 4 (2023)
Abstract
Apolipoprotein A-IMilano (Apo A-IMilano) is a natural mutant of Apolipoprotein. It is currently the only protein that can clear arterial wall thrombus deposits and promptly alleviate acute myocardial ischemia. Apo A-IMilano is considered as the most promising therapeutic protein for treating atherosclerotic diseases without obvious toxic or side effects. However, the current biopharmaceutical platforms are not efficient for developing Apo A-IMilano. The objectives of this research were to express Apo A-IMilano using the genetic transformation ability of N. tabacum. The method is to clone the coding sequence of Apo A-IMilano into the plant binary expression vector pCHF3 with a Flag/His6/GFP tag. The constructed plasmid was transformed into N. tabacum by a modified agrobacterium-mediated method, and transformants were selected under antibiotic stress. PCR, RT-qPCR, western blot and co-localization analysis was used to further verify the resistant N. tabacum. The stable expression and transient expression of N. tabacum were established, and the pure product of Apo A-IMilano was obtained through protein A/G agarose. The results showed that Apo A-IMilano was expressed in N. tabacum with a yield of 0.05 mg/g leaf weight and the purity was 90.58% ± 1.65. The obtained Apo A-IMilano protein was subjected to amino acid sequencing. Compared with the theoretical sequence of Apo A-IMilano, the amino acid coverage was 86%, it is also found that Cysteine replaces Arginine at position 173, which indicates that Apo A-IMilano, a mutant of Apo A-I, is accurately expressed in N. tabacum. The purified Apo A-IMilano protein had a lipid binding activity. The established genetic modification N. tabacum will provide a cost-effective system for the production of Apo A-IMilano. Regarding the rapid propagation of N. tabacum, this system provides the possibility of large-scale production and accelerated clinical translation of Apo A-IMilano.
Graphical Abstract
Introduction
Atherosclerosis can result in coronary and peripheral artery diseases, such as stroke or heart attack. Epidemiological studies have demonstrated an inverse correlation between the levels of high-density lipoprotein (HDL) cholesterol, the so called “good cholesterol,” with the risk of atherosclerosis (Kontush 2020; Chen et al 2020). As the principal component of HDL, Apolipoprotein A-I (Apo A-I) is believed to play an important role in the prevention of atherosclerosis via the process of reverse cholesterol transport (RCT) and anti-inflammatory function (Gaddis et al. 2018; Jackson et al. 2021; Barrett et al. 2019). Normally, low levels of HDL cholesterol would be a high risk of atherosclerosis. However, researchers noticed some inhabitants in an Italian town with low levels of HDL cholesterol but did not affect by atherosclerotic diseases (Franceschini et al. 1980; Weisgraber et al. 1980). Further approach figured out that these subjects expressed a variant of Apo A-I, designated as Apo A-IMilano, with its arginine at position 173 replaced with cysteine (Weisgraber et al. 1983).
Since the discovery of the variant Apo A-IMilano, researchers have put effort into figure out whether Apo A-IMilano possesses superior atheroprotective effects than the wild type of Apo A-I thus could be developed into a therapeutic. Kaul et al. (Kaul et al. 2004) verified treatment with Apo A-IMilano/phospholipid complex could rapidly improve the endothelial dysfunction in hypercholesterolemic Apo E-null mice. Studies on animal injury models (Ibanez et al. 2008; Kaul et al. 2003; Marchesi et al. 2008; Parolini et al. 2008; Speidl et al. 2010) and atherosclerosis patients (Nissen et al. 2003) indicated an infusion of ETC-216 (the complex of recombinant Apo A-IMilano with 1-palmitoyl-2-oleoyl phosphatidylcholine) or its mimetic resulted in plaque regression and reduction of reperfusion injury. Expression of Apo A-IMilano in Apo B/human Apo A-II (h-B/A-II) transgenic mice showed similar atheroprotective features with that expression of Apo A-I gene (L. Wang et al. 2006). However, gene therapy with macrophage-specific expression of Apo A-IMilano exerted a superior effect in the treatment of atherosclerosis in Apo A-I/Apo E double-knockout mice after bone marrow transplantation than Apo A-I (L. Wang et al. 2006). In another study, an infusion of HDLMilano twice with a 4-day interval showed better anti-inflammatory and plaque stabilizing properties than HDL wild type in the treatment of atherosclerotic New Zealand White rabbits (Ibanez et al. 2012). Apo A-IMilano also showed an anti-oxidant activity that distinguished from Apo A-Iwild type (Bielicki and Oda 2002). Recently, a report demonstrated that intravenous delivery of human recombinant Apo A-IMilano to the APP23-transgenic mouses reduced their β-amyloid cerebral deposition indicating potential ability to ease Alzheimer (Fernandez-de Retana et al. 2017).
Bioactive experiments and clinical trials require a great amount of Apo A-IMilano. Furthermore, considering the prevalent population with arthrosclerosis, application of Apo A-IMilano in the future will also require sufficient Apo A-IMilano. Thus, it is essential to develop a cost and capacity efficient manufacturing platform. Recombinant expression of Apo A-IMilano has been achieved in E. coli (Li et al. 2005; Persson et al. 1998; Zhuang et al. 2006), yeast (Zhang et al. 2008). However, copurification of the recombinant Apo A-IMilano with host cell protein is a problem when expressed in E. coli. Purification methods have been optimized to improve the production process (Hunter et al. 2008a, 2007, 2008b; Nord 2000).
Plant-based expression systems are effective for therapeutic protein expression (Fausther-Bovendo et al. 2021; Maharjan et al. 2021; Pillet et al. 2019; Loh et al. 2017). Nykiforuk et al. (Nykiforuk et al. 2011) successfully expressed bioactive Apo A-IMilano in transgenic safflower seeds.
Various expression strategies supply more and more opportunities to the production of pharmaceutical proteins and enzymes of commercial interest in both prokaryotic and eukaryotic species. Among the different expression platforms involving different organisms, plants have long been potential taken as an attractive platform for the production of unlimited number of recombinant proteins, including pharmaceutical proteins, such as monoclonal antibodies, vaccines, and enzymes. The first recombinant plant-derived pharmaceutical protein proved to be human serum albumin expressed in transgenic N. tabacum and potato plants in 1990 (Sijmons et al. 1990). Compared to traditional approaches in molecular farming of pharmaceuticals, the plant expression systems obviously showed advantages including their low costs, particularly when considering large-scale production. Microbial and animal cell cultures require specific equipment and electric energy supply, while plants can synthesize any protein and metabolite from CO2 and inorganic chemicals using solar energy. In addition, the limited risks of contamination by viruses or pathogens can be minimized. Moreover, protein purification can be eliminated when suitable plant tissue containing recombinant protein is used as food, such as lettuce leaves, tomato fruit. Importantly, plants also displayed capable of conducting complex post-translational modifications required for recombinant pharmaceutical proteins, including N-glycosylation, which is substantially similar to that found in mammalian cells. Many plant species have been tested for their ability to produce recombinant pharmaceutical proteins, including Nicotiana species, safflower, tomato, potato, soybean, alfalfa, spinach, A. thaliana, corn, and rice. N. tabacum is one of the ideal expression systems in plant bioreactor based on several practical advantages over other crops. It produces significant leaf biomass (up to 100 t of leaf biomass per hectare), has high soluble protein content and is a non-food crop. In addition, various methods of protein expression could be carried out in N. tabacum, including transient or stable expression via the agrobacterium. So far, it has been reported that stable nuclear transformation in Nicotiana tabacum has commonly been used as an excellent production platform of some therapeutic antibodies (Sack et al. 2015; Buyel et al. 2017). More importantly, the stable transformation of transgenic N. tabacum requires neither costly fermenters, nor vacuum infiltration equipment, nor sterile conditions. Although N. tabacum taken as an ideal plant for the production of medicinal proteins has many advantages, yet several challenges need to be addressed to achieve comparable efficiency as the mammalian system. The relatively low expression frequency was one of the main challenges in promoting N. tabacum is a significant recombinant protein production system. So far, there is still a lack of N. tabacum culture system for the expression of Apo A-IMilano.
In order to explore the method of producing Apo A-IMilano in the plant reactor, in this study, the model plant N. tabacum tissue culture technology and Agrobacterium mediated genetic transformation were used to obtain transformed plants. The surviving transformed plants were verified by PCR and RT-PCR technology. The obtained positive plants were harvested seeds and then continued to be planted, propagated and identified to obtain a stable genetic N. tabacum line. Meanwhile, the expression, subcellular localization and purification of Apo A-IMilano protein in N. tabacum were completed by transient transformation, fluorescence labeling and chromatography. This study was the first to report the transient and stable expression of Apo A-IMilano protein in N. tabacum.
Materials and methods
Construction of plant expression Vector pCHF3–Flag–Apo A-IMilano, pCHF3–Apo A-IMilano–GFP, pCHF3–GFP, and pCHF3–His6tag–GFP–TEV–Apo A-IMilano
The DNA of the Apo A-IMilano gene was synthesized by GENEWIZ Company (GENEWIZ, China). To facilitate the detection of the target protein by western blot, a 3 × Flag tag was added to the N-terminus of the recombinant protein. Phanta Max Master Mix PCR kit (Cat. No. P525, Vazyme, China) was used and PCR was performed using gene-specific primers (forward 5’-CGGGGGACGAGCTCGGTACCATGGTTAACGACTACAAAGACGATGACGACAAGGACTACAAAGACGATGACGACAAGGACTACAAAGACGATGACGACAAGGATGAGCCTCCTCAATC-3’and reverse 5’-GCAGGTCGACTCTAGATCATTGAGTATTAAGCTTCTT-3’) by the following protocol: 98 °C for 2 min, followed by 35 cycles of amplification (94 °C for 40 s, 58 °C for 30 s, 72 °C for 30 s, with the final elongation step at 72 °C for 5 min.). The PCR product was purified with a Gel Extraction Kit (Transgenes, China), then cloned into the pCHF3 vector (kindly provided by Tobacco Research Institute of Chinese Academy of Agricultural Sciences) using ClonExpress® Ultra One Step Cloning Kit (Vazyme, China). The empty pCHF3 was digested with KpnI and XbaI to obtain pCHF3–Flag–Apo A-IMilano. The recombinant constructs were transferred into E. coli DH5α competent cells. Grown colonies were detected by the PCR method using the specific forward and reverse primers (forward 5’-GCAAGTGGATTGATGTGATAT-3’ and reverse 5’-TAAGCTTCTTAGTATATTCTTC-3’). Then, the clone was sequenced to confirm the correct sequence, which is a 934 bp long fusion gene of vector, 3xFlag and Apo A-IMilano. The gene Apo A-IMilano was driven by the control of the strong cauliflower mosaic virus (CaMV) 35S promoter in pCHF3. Then, the construction was transformed into Agrobacterium tumefaciens (A.tumefaciens) strain GV3101 (Biomed, China) using freeze-thaw method (Fig. 1).
To further detect the distribution and localization of the target protein in tissues and cells, we also constructed a plasmid expressing pCHF3–Apo A-IMilano–GFP fusion protein and took pCHF3–GFP as the control. Simultaneously, pCHF3–his6tag–GFP–TEV–Apo A-IMilano plasmid was also constructed for the purification of the target protein Apo A-IMilano and its amino acid sequence determination and analysis. The construction method was the same as that of pCHF3–Flag–Apo A-IMilano. The recombinant plasmid was cloned and identified by GENEWIZ Company (Fig. 1).
Preparation of agrobacterium strains harboring pCHF3–Flag–Apo A-IMilano for infiltration
To prepare the appropriate scale A. tumefaciens, GV3101 harboring pCHF3–Flag–Apo A-IMilano was cultured in 50 ml of YEB medium supplemented with 100 µg/ml of spectinomycin and 50 µg/ml of rifampicin. Then, the cultures were incubated at 28 ℃ in 230 rpm constant shaking condition overnight. To prepare infiltration buffer, the A. tumefaciens culture mentioned above were harvested by centrifugation at 6000 rpm for 5 min at room temperature, then, prepared infiltration buffer (10 mM MES, 150 μM AS, 10 mM MgCl2) dissolved the suspension and the OD600 was adjusted to 0.8 to 1.0. Then, the culture was incubated at room temperature without any agitation for at least 3 h before infiltration. Preparation of A. tumefaciens GV3101 for pCHF3–Apo A-IMilano–GFP and pCHF3–GFP was as same with pCHF3–Flag–Apo A-IMilano.
The growth conditions of N. tabacum and preparation of N. tabacum leaves disks for stable transformation
Seeds of N. tabacum were obtained from China National GeneBank (ID: CNSebb2006170), Seeds of Hong Hua Da Jin Yuan (HD) were obtained from TRI of the Chinese Academy of Agricultural Sciences (ID: HD), originally donated by the Chinese Academy of Agricultural Sciences for collection of seeds. Seeds were surface-sterilized using 75% alcohol for 1 min 30 s and 10% sodium hypochlorite for 15 min followed by washing with autoclaved distilled water 3 times. The seeds were then grown on Murashige and Skoog (MS) medium. The pots were placed in a growth chamber under controlled conditions of 25–30 ℃with 16 h light/8 h dark photoperiod. All plant materials used in this experimental study abide by the national safety implementation measures and management regulations in the process of planting, transformation, sampling and testing, these regulations include “Safety Administration Implementation Regulation on Agricultural Biological Genetic Engineering” and “Tobacco and Tobacco Products- Detecting Method of Genetically Modified Organism Contents (GB/T 24,310–2009)”.
The transformation of N. tabacum was performed by co-cultivation as described previously (Tang et al. 2005). The explants were subcultured in different mediums for shoot induction and root induction. Briefly, the leaf discs of 1 cm in diameter were prepared from the cultivation seedlings and incubated for 10 min in A. tumefacien solution (OD600 = 0.6–0.8). The leaf discs were then blotted onto filter paper to remove excess bacterial suspension. The infected leaves were plated on the co-cultivation medium (MS with 1 mg/L 6-BA, 0.1 mg/L IAA) with the veins facing up, and cultured in the dark at 25 °C for 3 days. Then, leaf discs were placed upside down on S1 medium (MS with 1 mg/L 6-BA, 0.1 mg/L IAA, 500 mg/L cefotaxime sodium and 50 mg/L kanamycin) for 2–3 weeks. Then, the leaf discs were transferred to S2 medium (MS with 0.5 mg/L 6-BA, 0.05 mg/L IAA, 500 mg/L cefotaxime sodium, and 50 mg/L kanamycin) for 1–2 weeks. Then, seeding grow from the callus was then transferred onto S3 medium (MS with 0.5 mg/L 6-BA, 0.02 mg/L IAA, 500 mg/L cefotaxime sodium and 50 mg/L kanamycin) for 1–2 weeks and then transferred onto R medium (MS with 500 mg/L cefotaxime sodium and 50 mg/L kanamycin) until the root was detected. All tissue culture experiments were conducted in a growth chamber at 25 ℃ and a photoperiod of 16 h/8 h day/night. The well-rooted transgenic plants were transferred to soil under a controlled photoperiod of 16 h light/8 h dark at 25 ℃.
N. tabacum seeds were sterilized with 75% alcohol for 1 min and 30 s and 10% sodium hypochlorite for 15 min followed by washing with autoclaved distilled water 3 times. After disinfection, sow seeds into MS medium (Fig. 2A), and moved the seedlings were to a tissue culture flask when they grew to about 0.5 cm; when the number of leaves reached about 8 leaves (Fig. 2B), green leaves were selected for agrobacterium infection. pCHF3–Flag–Apo A-IMilano was transferred into N. tabacum leaves using agrobacterium-mediated method and co-cultured for 3 days (Fig. 2C). The co-cultured leaves were then inoculated on S1 medium (Fig. 2D), and the generation of tufted buds could be seen about 2 weeks later (Fig. 2E). The tuft buds in S1 medium were transferred to S2 and S3 medium, and after about 2 weeks of culture, the tuft buds grew into young seedlings (Fig. 2F). When the resistant seedlings grew to about 3 cm, small seedlings were cut and transferred to R medium to induce rooting, and roots were generated and seedlings gradually formed about 2 weeks later (Fig. 2G). After the seedlings were grown, the seedlings were transplanted into the flowerpots in the greenhouse (Fig. 2H).
Molecular characterization of stable transgenic N. tabacum
Genomic DNA was extracted from the leaves of putative transgenic N. tabacum lines using a Plant DNA extraction Kit (CWbio Inc., China) following manufacture’s protocol. PCR analyses were performed using primer sequences (forward 5’-GCAAGTGGATTGATGTGATAT-3’ and reverse 5’-TAAGCTTCTTAGTATATTCTTC-3) to identify positive transgenic plants. The cycling schedule of PCR was 95 ℃ for 10 min; 30 cycles of 95 ℃ for 1 min, 60 ℃ for 1 min, and 72 ℃ for 50 s, with a final extension at 72 ℃ for 10 min. PCR products were electrophoresed on 1.5% agarose gel, then stained with ethidium bromide and visualized under UV light. The amplified DNA fragment including vector, 3xFlag and Apo A-IMilano was 934 bp.
For fluorescence quantitative analysis of transgenic N. tabacum, total RNA from N. t tabacum leaves was extracted after quick-freezing in liquid nitrogen. The cDNA was reversely transcribed (PrimeScriptTM RT reagent Kit with gDNA Eraser, Code No. RR047A, Takara, Japan) and analyzed by fluorescent quantitative PCR. Actin (NT-L25) was selected as the reference gene, and the primer sequence was as follows: Actin-F: GCTAAGGTTGCCAAGGCTGTC; Actin-R: TAAGGTATTGACTTTCTTTGTCTGA; The PCR primer sequence of the Apo A-IMilano target gene was F: AGCCTCCTCAATCTCCTTGG; R: TTGCTTACCAAGAGCAGAACCT. Total RNA was extracted from stable transgenic and non-transgenic N. tabacum leaves tissues using the RNA extraction kit (Transgene, China) according to the manufacturer’s instruction. First-strand cDNA was synthesized after genomic DNA was eliminated by DNase I. RT-qPCR was performed using the following first-strand cDNA as template using the procedure: 95 °C for 300 s; 40 cycles of 95 °C for 10S, 60 °C for 30S; 95 ℃ for 15 s, 60 ℃ for 60 s.
For Western blotting of the stable transformation, proteins were extracted from the transformation and non-transformed leaves of N. tabacum using lysis buffer (Thermo, USA) and protease inhibitor. The samples were centrifuged at 14,000 × g for 15 min before loading on 4% stacking and 12% separating SDS–polyacrylamide gel (SDS–PAGE) after boiling at 100 °C for 10 min. The mouse monoclonal antibody against human Apo A-I (Santa Cruz, USA) was used as the primary antibody. The antibody was diluted to 300-fold and used to incubate the electrophoretically separated protein extract and the electroimprinted membrane. The goat anti mouse (Proteintech, USA) antibody diluted 5000-fold was used as the second antibody.
Infiltration of N. tabacum using a syringe for transient transformation
N. tabacum grown under constant light conditions for 4 weeks in a greenhouse was taken to infiltrate using syringe according to the described by Abd-Aziz, N. et al. (Abd-Aziz et al. 2020). Briefly, the infiltration buffer with OD600 of 0.8–1.0 containing A. tumefaciens strain GV3101 harboring pCHF3–Flag–Apo A-IMilano synthesized by GENEWIZ Company were respective injected into the leaf with a syringe without a needle. Then, the plants were cultured in a 24 h dark condition. At least 3 days post-infiltration culture before the following treatment including analysis of mRNA and protein expression (Fig. 3).
RT-PCR and western blotting of transient transformation
Total RNA was extracted from transient transgenic and non-transgenic N. tabacum leaves tissues using the RNA extraction kit (Transgene, China) according to the manufacturer’s instruction. First-strand cDNA was synthesized after genomic DNA was eliminated by DNase I. PCR kit (TB Green® Premix Ex Taq™, Code No.: RR420A, Takara, Japan) was used and PCR was performed using the following first-strand cDNA as a template using the procedure: 95 °C for 300 s; 30 cycles of 95 °C for 15S, 45 °C for 30S, and 72 °C for 60S; and 72 °C for 300 s for a final extension. The amplified PCR products were analyzed by 1% TAE Agarose gel. (Forward 5’-ATGGTTAACGACTACAAAGACG-3’ and reverse 5’-TCATTGAGTATTAAGCTTCTTAGT-3’).
For Western blotting, the steps were the same as those for stable transgenic N. tabacum.
Subcellular localization of target protein in Nicotiana benthamiana
Seeds of Nicotiana benthamiana (N. benthamiana) were obtained from China National GeneBank (ID: CNS0440294), N. benthamiana plants grown in a growth chamber under controlled conditions of 25–30 ℃, 70% relative humidity with 16 h light/8 h dark photoperiod. All plant materials used in this experimental study abide by “Safety Administration Implementation Regulation on Agricultural Biological Genetic Engineering” and “Tobacco and Tobacco Products- Detecting Method of Genetically Modified Organism Contents (GB/T 24,310–2009)”.
GV3101 containing pCHF3–Apo A-IMilano–GFP, pCHF3–GFP, and ER marker plasmid were, respectively, grafted into 10 ml YEB liquid medium (yeast extract 4.0 g/L, mannitol 10.0 g/L, NaCl 0.1 g/L, MgSO4 0.2 g/L, K2HPO4 0.5 g/L, pH = 7.0) and cultured at 170 rpm for 1 h. Then, the supernatants were removed and collected by centrifugation at 4000 rpm for 4 min. The bacteria were re-suspended with 10 mM MgCl2 (with 120 μM AS) suspension and OD600 was adjusted to about 0.6. N. tabacum plants with good growth conditions were selected, and agrobacterium containing marker plasmids and agrobacterium containing pCHF3–Apo A-IMilano–GFP/pCHF3–GFP vector plasmids were suspended together for the operation. The endoplasmic reticulum (ER) localization signal protein was Sper, its amino acid sequence was MKTNLFLFLFLIFSLLLSLSSAEF. The mixture was mixed in a ratio of 1:1, and injected from the lower epidermis of N. benthamiana leaves with a 1 ml syringe without the spear head and made notes. The injected N. benthamiana plants were cultured under low light for 2d, and the N. benthamiana leaves injected with labeled agrobacterium tumefaciens were made into glass slides, which were observed under a laser confocal microscope (Nikon, Japan) and photographed. The Sper excitation light was 561 nm and the emitting light was 580 nm. Chloroplast fluorescence signal excitation wavelength was 640 nm and the emission wavelength was 675 nm.
Purification of expressed target proteins from transient transformation
When the GV3101 Agrobacterium with the target gene had an OD600 value of 0.8–1.0, let it stand for 3 h at room temperature. After the standstill was completed, the N. tabacum leaves in good condition were injected with a 1 ml needleless syringe. After the injection was completed, culture was in the greenhouse for 72 h for the sample. Put 40 fresh leaves (7 g) into liquid nitrogen and ground to powder, add a lysis buffer (Thermo, USA) with protease inhibitor to the powder on ice; then centrifuged for 15 min to take the supernatant, and added Flag antibody (Sigma-Aldrich, USA) to mix overnight at 4 °C. After that added protein A/G (Thermo, USA) to the supernatant, mixed for 3 h at 4 °C, the samples were centrifuged at 800 × g. Then collected protein A/G and washed them with 1 × PBS. After 3 times, the protein was eluted with Tris–HCl (PH = 7.4). Diluted a portion of the eluted protein by 10 times was used for the BCA protein concentration determination.
Determination of protein purity by SDS–PAGE
This experiment was conducted by protein purity determination SDS–PAGE method according to 《Guide to Protein purification》(Second Edition, Edited by Richard R. Burgess and Murray P. Deutscher. 2009. Elsevier Inc.). In brief, the purity of purified Apo A-IMilano and Flag fusion protein was detected by SDS–PAGE gel staining. The purified protein solution is subjected to SDS–PAGE. Followed by Coomassie brilliant blue staining and then decolorized to enter the automatic gel imaging system (Tanon-3500R, Shanghai Tanon Technology Co., Ltd., China) for exposure using white light source to obtain gel images. and the image is saved as a TIFF file. ImageJ (NIH) is used to quantify the grayscale of the purified protein in the gel image (Alonso Villela SM et al. 2020), and the ratio of the purified Flag–Apo A-IMilano to the total protein was obtained, which was calculated as the purity of the purified protein.
The amino acid sequence of Apo A-IMilano in N. tabacum was analyzed by mass spectrometry
The fusion protein produced according to step 2.5 was purified with a His protein purification kit (Thermo, USA), and then the amino acid sequence of the fusion protein was analyzed according to the following steps: the protein solution was reduced with 2 µl 0.5 M Tris (2-carboxyethyl) phosphine (TCEP) (Sigma, USA) at 37 °C for 60 min and alkylated with 4 µl 1 M iodoacetamide (IAM) at room temperature for 40 min in darkness. Five folds volumes of cold acetone (Sinopharm, China) were added to precipitate protein at − 20 °C overnight. After centrifugation at 12000 g at 4 °C for 20 min, the pellet was washed twice by 1 ml pre-chilled 90% acetone aqueous solution. Then, the pellet was re-suspended with 100 µl 10 mM Triethylammonium bicarbonate (TEAB) (Sigma, USA) buffer. Trypsin (Promega, USA) was added at 1:50 trypsin-to-protein mass ratio and incubated at 37 °C overnight. The peptide mixture was desalted by C18 ZipTip (Shimadzu Corporation, 5010–21,701, Japan), and lyophilized by SpeedVac (Thermo Scientific, Savant SPD1010, USA). The sequence of the fusion protein was confirmed at Qingdao Sci-tech Innovation Quality Testing Co. Ltd.
Activity detection of target proteins
Dimyristoyl Phosphatidylcholine (DMPC) dry powder was suspended in TBS (PH = 7.4, 3.5 mg/mL) at a concentration of 1.2 mg/ml. It oscillated violently on the vortex oscillator for 3–5 min to form multilayer liposomes. The purified protein sample was diluted to 0.17 mg/ml. The 200 µl target protein samples and 50 µL of DMPC liposome were incubated in 24 ℃ water baths for 10 min. Total divided into three groups: negative control group DMPC + TBS (PH = 7.4, 3.5 mg/ml); DMPC + purified target protein in the experimental group; Positive control group DMPC plus standard substance (in this experiment, the mass ratio of Apolipoprotein to DMPC liposome was 1:2, to be exact, Apolipoprotein final concentration: 0.12 mg/ml; DMPC liposome final concentration: 0.24 mg/ml). The absorbance value at 325 nm was measured at room temperature, every 2 min, and monitored for 60 min until the absorbance value stabilized. The decrease in absorbance of three independent samples ± SD was plotted over time.
Statistical analysis
All data are expressed as mean ± standard deviation, the mean comparison between the two groups was performed by t test, and a two-tailed test P < 0.05 was considered statistically significant.
Results
Introduction of exogenous genes and identification in stable transgenic N. tabacum
Regeneration and identification of stable transgenic N. tabacum
Considering that N. tabacum leaves could produce high biomass, we carried out Apo A-IMilano ectopically overexpressed in N. tabacum using the binary vector pCHF3, in which the target gene was driven by 35CaMV. 17 putative transgenic plants were obtained from explant using antibiotic resistance selection. Genomic DNA was used as the template, PCR using gene-specific primers was carried out to detect the T-DNA insertion; the results demonstrated that the target band (Fig. 4A) was observed in the transgenic strain but not wild types, indicating stable Apo A-IMilano gene integration into the genome of the N. tabacum.
mRNA expression in stable transgenic N. tabacum
Fluorescence quantitative PCR was used to analyze the expression levels of target genes in stable transgenic N. tabacum. The reference gene NT-L25 was used for correction and standardization. The results showed the relative expression level of P478 batch N. tabacum (Fig. 4B), which was used for further detection and analysis.
Protein detection in stable genetic N. tabacum
SDS–PAGE was used to analyze the protein in the leaves of stable transgenic N. tabacum. Compared with the wild-type N. tabacum leaves, the expected band appeared at 30 KDa in transgenic P478 batch N. tabacum leaves, whereas no obvious band was found in wild-type lines. The expected band appeared at 28 KDa in the positive control, as shown in Fig. 4C. It can be preliminarily proved that Apo A-IMilano was expressed in N. tabacum leaves.
Transient transformation and analysis of Apo AIMilano in N. tabacum
mRNA expression in transient transgenic N. tabacum
To determine whether there is Apo A-IMilano transcription in transgenic N. tabacum, the expression of Apo A-IMilano in transgenic N. tabacum was detected by RT-PCR. As can be seen from Fig. 5, RT-PCR analysis verified that these N. tabacum were positive for transgenic N. tabacum.
Transient expression in N. tabacum Apo A-IMilano produced
Transient expression could provide fast protein expression within 3–5 days, which confers this strategy overcome some drawbacks and challenges associated with stable expression, including inadequate protein expression, time cost and so on. In this study, we used the vector pCHF3–Flag–Apo A-IMilano to generate a recombination protein in N. tabacum. The total protein was extracted from the leaf of 3 day post-infiltration and western blot was performed using Apo A-I monoclonal antibody (Santa Cruze Biotechnology Inc.). The results showed that recombinant protein was produced in N. tabacum at approximately 30 kDa (Fig. 6A).
Purification and purity of the transient transformation fusion protein Flag–Apo A-IMilano
The Flag–Apo A-IMilano protein was purified using proteinA/G agarose. Western blot results showed that the purified protein solution had only one clear band, and the size was consistent with the expected theoretical value (30 KDa), indicating that the target protein was purified to a higher degree. The protein concentration was determined by the bicinchoninic acid (BCA) method, according to the standard protein curve, the protein concentration of Flag–Apo A-IMilano after purification was calculated to be 0.84 mg/ml, a total of 0.4 mg (Fig. 6B). Coomassie blue staining of recombinant Flag–Apo A-IMilano proteins in SDS–PAGE (Fig. 6C). SDS–PAGE of Flag–Apo A-IMilano Purified Protein (Fig. 7A), Image of the SDS–PAGE of Flag–Apo A-IMilano Purified Protein (Fig. 7B), Quantification of the grayscale of the purified protein in the gel image with Image J (Fig. 7C).
Subcellular localization of Apo A-IMilano in N. benthamiana by confocal laser microscopy
To analyze the subcellular localization of Apo A-IMilano, pCHF3–Apo A-IMilano–GFP plasmid was constructed, and an empty pCHF3–GFP vector was injected into N. benthamiana leaves as the control, respectively, and observed by a laser microscope. It was found that the control group had strong green fluorescence signal in the cells, while pCHF3–Apo A-IMilano–GFP had green fluorescence in the endoplasmic reticulum of cells in N. benthamiana (Fig. 8), indicating that Apo A-IMilano was located in the endoplasmic reticulum.
Determination of amino acid sequence of Apo A-IMilano fused in N. tabacum
To confirm the accuracy of the expression of the target protein in N. tabacum, the amino acid sequences of Apo A-IMilano and Flag fusion proteins were determined and analyzed. The peptides were re-dissolved in solvent A (A: 0.1% formic acid in water) and analyzed by Orbitrap Fusion coupled to an EASY-nanoLC 1200 system (Thermo Fisher Scientific, MA, USA). Tandem mass spectra were processed by PEAKS Studio version 10.6 (Bioinformatics Solutions Inc., Waterloo, Canada). The amino acid sequence of the Apo A-IMilano present in the fusion protein is shown in Fig. 9 and yielded 86% coverage, it is also found that Cysteine replaces Arginine at position 173 (marked with red box), which indicates that Apo A-IMlano, a mutant of Apo A-I, is accurately expressed in N. tabacum.
Activity detection of Flag–Apo A-IMilano protein
The activity of Flag–Apo A-IMilano can be determined by dimyristoyl phosphatidyl choline (DMPC) turbidimetric clarification assay, which was used to measure the abilities of Flag–Apo A-IMilano protein to combine with lipids. When Flag–Apo A-IMilano was combined with DMPC, the turbidity of the reaction system decreased. The faster the turbidity decreased, the better the Flag–Apo A-IMilano could bind lipids. As can be seen from Fig. 10, the absorbance value of the blank control group only decreased a little, and the absorbance value of the standard product decreased fastest. The absorbance value of the purified target protein decreased at a rate similar to that of the standard product. Results from this assay showed similar trend in lipid binding activity for both the Flag–Apo A-IMilano sample derived from N. tabacum and human Apo A-I protein control.
Discussion
Pharmaceutical and clinical studies have indicated the potential functions of Apo A-IMilano in reducing atherosclerosis (Ibanez et al. 2008; Nissen et al. 2003; Parolini et al. 2008; L. Wang et al. 2006), preventing restenosis after coronary stenting (Kaul et al. 2003; Speidl et al. 2010), reducing myocardial ischemia (Marchesi et al. 2008) and easing features of Alzheimer’s disease (Fernandez-de Retana et al. 2017).Clinical application of Apo A-IMilano in the future will require a large amount of high quality and cost-effective Apo A-IMilano. Thus, various manufacturing systems have been developed. The basic quality of such a system is the ability to express the bioactive target protein. Other superior qualities of an appropriate production system include easily and cheaply for maintenance, cost-efficient, high productivity and the ability for large scale manufacturing.
In generalbioreactors could be classified into microorganism bioreactors, plant-based and animal-based bioreactors. The advantage of animal-based bioreactors is their ability to produce bioactive therapeutic proteins with high human compatibility. However, the cost is quite high for the construction and maintenance of an animal or animal cell bioreactor system (Y. Wang et al. 2013). Microorganism production systems are easy to operate and scale up. However, different translational modifications may lead to the expression of non-soluble and/or non-functional proteins (Swartz 2001). Plant-based bioreactors, such as transgenic plants and plant tissue culture systems, offer cheap and easily scalable production of materials (Xu et al. 2016).
Plant bioreactors can be divided into stable expression systems and transient expression systems according to whether exogenous genes can be stably inherited by offspring. Stable expression systems are the key technology for obtaining stable genetic transgenic plants. Compared with the stable expression system, transient expression does not need to integration foreign genes into the genome, which has the advantages of a short expression cycle and high expression volume (Nosaki et al. 2021), and is an important means for later functional analysis.
N. tabacum is a model plant, with advantages, such as easy planting, short growth period, high yield per plant, easy transfer of exogenous genes and mature genetic transformation system, so it can reduce production costs and provide possibilities for large-scale production of exogenous proteins. Therefore, we constructed three expression systems in N. tabacum at the same time to confirm the expression of Apo A-IMilano at the mRNA and protein levels, as well as determination of its amino acid sequence. The purpose was to quickly determine the expression characteristics and protein structure and function of Apo A-IMilano through the transient expression system, and to construct a stable expression system of Apo A-IMilano in N. tabacum, the purpose was to observe the genetic stability of Apo A-IMilano expression by subculturing Apo A-IMilano positive seeds harvested in a stable expression system. We also designed the fusion expression of Apo A-IMilano and Flag, and obtained the target protein with purity of 90.58% ± 1.65. N. tabacum was selected under antibiotic stress. PCR and RT-qPCR were performed to examine the presence of the Apo A-IMilano gene. Moreover, the expression of Apo A-IMilano was analyzed by Western blot.
Humanized proteins and plant derived proteins have great differences in post-translational modification, especially in glycosylation modification. Several literatures have reported glycosylation modification of plant chassis. The glycosylation of humanized proteins and plant derived proteins on endoplasmic reticulum is basically the same, but the glycosylation of proteins located in Golgi matrix is quite different (Schoberer et al. 2018). This study identified the organelle localization of the target protein through subcellular localization. The results showed that the Apo A-IMilano protein was located on the endoplasmic reticulum of N. bentamiana. It was speculated that the glycosylation modification of the Apo A-IMilano protein after expression in N. bentamiana should be consistent with that in mammalian cells, providing a basis for the next activity identification. the subcellular localization studies were performed with N. bentamiana rather than N. tabacum to avoid the huge overexpression in N. tabacum that hampers subcellular localization studies, so I chose N. bentamiana is used for subcellular localization.
In the experiment, to more accurately clarify the expression of Apo A-IMilano fusion protein in N. tabacum, the purified Apo A-IMilano fusion protein was sequenced and identified by tandem mass spectroscopy, according to the preliminary analysis, the amino acid sequence of Apo A-IMilano expressed in N. tabacum was compared with that of normal human Apo A-I sequence (274aa, Uniprot/Swiss prot: P02647.1), and the coverage rate was 86% which was analyzed together with the above other identification results, it shows the accuracy and authenticity of the expression of Apo A-IMilano in N. tabacum. Next, we further analyzed the post-translational modification of the protein expressing Apo A-IMilano in N. tabacum, O- and N-terminal glycosylation and its functional analysis and clinical trials, to further promote the possibility of its clinical application and accelerate the pace of its clinical application. The protein activity and function were analyzed by the DMPC turbidity clarification test. Meanwhile, post-translational modification, and protein function tests of exogenous proteins are underway. Although many scientists have recently done a lot of work on plant bioreactors and achieved unprecedented results, especially in the expression of medicinal proteins, some biopharmaceuticals beneficial to human health have also been discovered, including monoclonal antibodies and vaccines, some progress has also been made in the plant seed expression system (Nykiforuk et al. 2011). However, the expression of Apo A-IMilanno in the model plant N. tabacum is the first report. It is currently superior to other expression systems in terms of performance and yield. In addition, although using transgenic plants to produce medical protein provokes some concerns, such as the need to improve the amount of heterologous protein expressed, the doubt about the differences in the method of glycosylation, with the huge market demand and the tireless efforts of scientific research personnel, accompanied by the optimization and extensive use of the system step by step, it will come true using plant bioreactors to produce medical protein.
In conclusion, we presented the establishment of an N. tabacum culture system suitable for Apo A-IMilano expression. Our future work will focus on Apo A-IMilano bioactivity characterization. The final aim will be large scale production of bioactive Apo A-IMilano. The N. tabacum culture system appears to provide a viable, cost-efficient, and environmentally friendly platform for the production of pharmaceutically bioactive proteins.
Availability of data and materials
The data sets used and/or analyzed are available from the corresponding author on reasonable request.
References
Abd-Aziz N, Tan BC, Rejab NA, Othman RY, Khalid N (2020) A new plant expression system for producing pharmaceutical proteins. Mol Biotechnol 62:240–251
Alonso Villela SM, Kraïem H, Bouhaouala-Zahar B, Bideaux C, Aceves Lara CA et al (2020) A protocol for recombinant protein quantification by densitometry. Microbiologyopen 9:1175–1182
Barrett TJ, Distel E, Murphy AJ, Hu JY, Garshick MS et al (2019) Apolipoprotein AI) promotes atherosclerosis regression in diabetic mice by suppressing myelopoiesis and plaque inflammation. Circulation 140:1170–1184
Bielicki JK, Oda MN (2002) Apolipoprotein A-I(Milano) and apolipoprotein A-I(Paris) exhibit an antioxidant activity distinct from that of wild-type apolipoprotein A-I. Biochemistry 41:2089–2096
Buyel JF, Twyman RM, Fischer R (2017) Very-large-scale production of antibodies in plants: the biologization of manufacturing. Biotechnol Adv 35:458–465
Chen J, Zhang X, Millican R, Creutzmann JE, Martin S et al (2020) High density lipoprotein mimicking nanoparticles for atherosclerosis. Nano Converg 7:6
Fausther-Bovendo H, Kobinger G (2021) Plant-made vaccines and therapeutics. Science 373:740–741
Fernandez-de Retana S, Montanola A, Marazuela P, De La Cuesta M, Batlle A et al (2017) Intravenous treatment with human recombinant ApoA-I Milano reduces beta amyloid cerebral deposition in the APP23-transgenic mouse model of Alzheimer’s disease. Neurobiol Aging 60:116–128
Franceschini G, Sirtori CR, Capurso A, Weisgraber KH, Mahley RW (1980) A-IMilano apoprotein. decreased high density lipoprotein cholesterol levels with significant lipoprotein modifications and without clinical atherosclerosis in an Italian family. J Clin Invest 66:892–900
Gaddis DE, Padgett LE, Wu R, McSkimming C, Romines V et al (2018) Apolipoprotein AI prevents regulatory to follicular helper T cell switching during atherosclerosis. Nat Commun 9:1095
Hunter AK, Suda EJ, Das TK, Shell RE, Herberg JT et al (2007) Impact of denaturation with urea on recombinant apolipoprotein A-IMilano ion-exchange adsorption: equilibrium uptake behavior and protein mass transfer kinetics. Biotechnol J 2:110–120
Hunter AK, Hoeltzli SD, Johnson GV, Gustafson ME, Ho SV (2008a) Use of cyclohexanedimethanol as a nonflammable organic solvent for industrial scale reversed phase chromatography. J Chromatogr A 1202:107–110
Hunter AK, Suda EJ, Herberg JT, Thomas KE, Shell RE et al (2008b) Separation of recombinant apolipoprotein A-I(Milano) modified forms and aggregates in an industrial ion-exchange chromatography unit operation. J Chromatogr A 1204:42–47
Ibanez B, Vilahur G, Cimmino G, Speidl WS, Pinero A et al (2008) Rapid change in plaque size, composition, and molecular footprint after recombinant apolipoprotein A-I Milano (ETC-216) administration: magnetic resonance imaging study in an experimental model of atherosclerosis. J Am Coll Cardiol 51:1104–1109
Ibanez B, Giannarelli C, Cimmino G, Santos-Gallego CG, Alique M et al (2012) Recombinant HDL(Milano) exerts greater anti-inflammatory and plaque stabilizing properties than HDL(wild-type). Atherosclerosis 220:72–77
Jackson AO, Rahman GA, Long S (2021) Apolipoprotein-AI and AIBP synergetic anti-inflammation as vascular diseases therapy: the new perspective. Mol Cell Biochem 476:3065–3078
Kaul S, Rukshin V, Santos R, Azarbal B, Bisgaier CL et al (2003) Intramural delivery of recombinant apolipoprotein A-IMilano/phospholipid complex (ETC-216) inhibits in-stent stenosis in porcine coronary arteries. Circulation 107:2551–2554
Kaul S, Coin B, Hedayiti A, Yano J, Cercek B et al (2004) Rapid reversal of endothelial dysfunction in hypercholesterolemic apolipoprotein E-null mice by recombinant apolipoprotein A-I(Milano)-phospholipid complex. J Am Coll Cardiol 44:1311–1319
Kontush A (2020) HDL and reverse remnant-cholesterol transport (RRT) relevance to cardiovascular disease. Trends Mol Med 26:1086–1100
Li M, Zhao HL, Xue C, Zhang W, Zhang SM et al (2005) Soluble expression of recombinant human apoliprotein A-I-Milano in Escherichia coli. Sheng Wu Gong Cheng Xue Bao 21:354–359
Loh HS, Green BJ, Yusibov V (2017) Using transgenic plants and modified plant viruses for the development of treatments for human diseases. Curr Opin Virol 26:81–89
Maharjan PM, Choe S (2021) Plant-based COVID-19 vaccines: current status, design, and development strategies of candidate vaccines. Vaccines (basel) 9:992
Marchesi M, Booth EA, Rossoni G, Garcia RA, Hill KR et al (2008) Apolipoprotein A-IMilano/POPC complex attenuates post-ischemic ventricular dysfunction in the isolated rabbit heart. Atherosclerosis 197:572–578
Nissen SE, Tsunoda T, Tuzcu EM, Schoenhagen P, Cooper CJ et al (2003) Effect of recombinant ApoA-I Milano on coronary atherosclerosis in patients with acute coronary syndromes: a randomized controlled trial. JAMA 290:2292–2300
Nord K (2000) Ligands selected from combinatorial libraries of protein A for use in affinity capture of apolipoprotein A-1M and Taq DNA polymerase. J Biotechnol 80:45–54
Nosaki S, Miura K (2021) Transient expression of recombinant proteins in plants. Methods Enzymol 660:193–203
Nykiforuk CL, Shen Y, Murray EW, Boothe JG, Busseuil D et al (2011) Expression and recovery of biologically active recombinant Apolipoprotein AI(Milano) from transgenic safflower (Carthamus tinctorius) seeds. Plant Biotechnol J 9:250–263
Parolini C, Marchesi M, Lorenzon P, Castano M, Balconi E et al (2008) Dose-related effects of repeated ETC-216 (recombinant apolipoprotein A-I Milano/1-palmitoyl-2-oleoyl phosphatidylcholine complexes) administrations on rabbit lipid-rich soft plaques: in vivo assessment by intravascular ultrasound and magnetic resonance imaging. J Am Coll Cardiol 51:1098–1103
Persson J, Nyström L, Ageland H, Tjerneld F (1998) Purification of recombinant apolipoprotein A-1Milano expressed in Escherichia coli using aqueous two-phase extraction followed by temperature-induced phase separation. J Chromatogr B Biomed Sci Appl 711:97–109
Pillet S, Couillard J, Trépanier S, Poulin JF, Yassine-Diab B et al (2019) Immunogenicity and safety of a quadrivalent plant-derived virus like particle influenza vaccine candidate-two randomized Phase II clinical trials in 18 to 49 and ≥50 years old adults. PLoS ONE 14:e0216533
Sack M, Rademacher T, Spiegel H, Boes A, Hellwig S et al (2015) From gene to harvest: insights into upstream processdevelopment for the GMP production of a monoclonalantibody in transgenic tobacco plants. Plant Biotechnol J 13:1094–1105
Schoberer J, Strasser R (2018) Plant glyco-biotechnology. Semin Cell Dev Biol 80:133–141
Sijmons PC, Dekker BM, Schrammeijer B, Verwoerd TC, van den Elzen PJ et al (1990) Production of correctly processed human serum albumin in transgenic plants. Bio/technology 8:217–221
Speidl WS, Cimmino G, Ibanez B, Elmariah S, Hutter R et al (2010) Recombinant apolipoprotein A-I Milano rapidly reverses aortic valve stenosis and decreases leaflet inflammation in an experimental rabbit model. Eur Heart J 31:2049–2057
Swartz JR (2001) Advances in Escherichia coli production of therapeutic proteins. Curr Opin Biotechnol 12:195–201
Tang DQ, Qian HM, Zhao LX, Tang KX, Huang DF (2005) The study of transformation of tobacco with the stress responsible gene BoRS1 from Brassica oleracea var. acephala. Sheng Wu Gong Cheng Xue Bao 21:489–492
Wang L, Sharifi BG, Pan T, Song L, Yukht A et al (2006) Bone marrow transplantation shows superior atheroprotective effects of gene therapy with apolipoprotein A-I Milano compared with wild-type apolipoprotein A-I in hyperlipidemic mice. J Am Coll Cardiol 48:1459–1468
Wang Y, Zhao S, Bai L, Fan J, Liu E (2013) Expression systems and species used for transgenic animal bioreactors. Biomed Res Int 2013:580463
Weisgraber KH, Bersot TP, Mahley RW, Franceschini G, Sirtori CR (1980) A-Imilano apoprotein. Isolation and characterization of a cysteine-containing variant of the A-I apoprotein from human high density lipoproteins. J Clin Invest 66:901–907
Weisgraber KH, Rall SC, Bersot TP, Mahley RW, Franceschini G et al (1983) Apolipoprotein A-IMilano. Detection of normal A-I in affected subjects and evidence for a cysteine for arginine substitution in the variant A-I. J Biol Chem 258:2508–2513
Xu N, Wang Y, Ma J, Jin L, Xing S et al (2016) Over-expression of fHbp in Arabdopsis for development of meningococcal serogroup B subunit vaccine. Biotechnol J 7:973–980
Zhang Y, Zhao Z, Wang M, Song D (2008) Secretion expression of human recombinant Apo A-I Milano in yeast Pichia pastoris. J Fudan Univ 47:306–310
Zhuang Y, Ma W, Guo M, Ding M, Chu J et al (2006) High cell density and high expression of recombinant human ApoA-IMilano in Escherichia coli by twice temperature-shifted induction. Front Biol China 1:345–348
Acknowledgements
The authors would like to thank TRI of Chinese Academy of Agricultural Sciences g for their assistance with the experiments.
Funding
This research was funded by Hebei Development and Reform Commission of China, Hebei Engineering Laboratory, Grant number (2021) 1157.
Author information
Authors and Affiliations
Contributions
S.-J.A., and W.Z. did Experimental design; S.-J.A. and W.Z. did Manuscript writing; S.-J.A., W.Z., L.-Y.Z., H.-J.X. did Writing original draft preparation; W.Z., L.-Y.Z., J.K., Z.-H.H., Y.-D.G., Z.-X.Z., Y.-J.Z., R.-Y.W., H.-J.X. did Experimental method and operation; H.-J.X. did project administration. All authors read and approved the final manuscript.
Corresponding authors
Ethics declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Additional information
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Zhao, W., Zhou, LY., Kong, J. et al. Expression of recombinant human Apolipoprotein A-IMilano in Nicotiana tabacum. Bioresour. Bioprocess. 10, 4 (2023). https://doi.org/10.1186/s40643-023-00623-w
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s40643-023-00623-w